Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting VH-(G4S)3-VL ScFv fragment was further fused at the N-terminus of the murine TNF gene through a S4G-linker and the final construct VH-(G4S)3-VL-(S4G)3-TNF was then cloned into the mammalian expression vector pcDNA3.1 (+) vector (Invitrogen). A VH-(G4S)3-VL ScFv fragment specific for hen egg lysozyme (KSF)(34) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: Total mRNA from 3 CT-PAK2EC and 3 KO-PAK2EC average-sized tumors was extracted using TRIZOL reagent (Invitrogen) according to recommended procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... was injected into buccal mucosa of tumor-bearing KOG mice 3 times every 3 days along with 100 μg polyI:C (Invitrogen) as adjuvant.
-
bioRxiv - Physiology 2020Quote: ... βTC3 cells were transfected with plasmids encoding mouse furin and/or mouse insulin receptor (pcDNA3.1 backbone) and/or mouse Atp6ap1/Ac45-Flag using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... for more than 1.5 hours in a shaker and incubated with the primary antibody (Mouse anti- GAD67, Millipore; Mouse anti-CaMK2a, Abcam; Mouse anti-mCherry, Invitrogen) in 0.2% Triton and 5% Goat serum in PBS at 4 °C for 24 -36 hours ...
-
bioRxiv - Immunology 2021Quote: ... goat anti-mouse IgG or anti-mouse IgA conjugated with HRP (Invitrogen) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with Mouse-on-Mouse IgG Blocking Solution (Invitrogen R37621) at room temperature for 30 min and rinsed three times with TBS-T (0.05 % tween-20) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 (Invitrogen) 1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Por1 (Invitrogen), and rabbit anti-Sec61 (generous gift from Martin Spiess ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Pgk1 (Invitrogen), mouse anti-Por1 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse (Invitrogen 35518) were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-GFP (Invitrogen) and anti-HA (Biolegend) ...
-
bioRxiv - Cancer Biology 2019Quote: ... AF594-anti-mouse (Invitrogen). Small molecular compounds such as 2-BP (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-V5 (Invitrogen), STAM (ProteinTech) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-CD79a (ThermoFisher); mouse anti-CD4 (AbD Serotec) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse αGFP (Invitrogen) at appropriate dilutions.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse laminin (Thermofisher). Within 24–30 h of initial dissociation neurons were pelleted by centrifugation (5 min ...
-
bioRxiv - Microbiology 2021Quote: ... Donkey anti-mouse (Invitrogen) and Donkey anti-rat (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... mouse Ub-K63 (ThermoFisher) or rabbit anti-GST (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-RetP1 (ThermoFisher) (1:100) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-Prdx5 (Invitrogen), rabbit anti-hnRNPK (CST) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gapdh (mouse) (Life technologies) (24) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse (Thermo Scientific) or by HRP-conjugated secondaries (Bio-Rad) ...
-
bioRxiv - Bioengineering 2021Quote: ... Laminin Mouse Protein (ThermoFisher) was added to the solution containing calcium and cells to a final concentration of 1 mg/mL ...
-
bioRxiv - Immunology 2022Quote: ... anti-Mouse IgG (Invitrogen) was used as isotype control ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-mouse (A11017; Invitrogen), Alexa Fluor 488 goat ...
-
bioRxiv - Biochemistry 2019Quote: ... mouse IgG (ThermoFisher Scientific), goat IgG (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... Myc (Thermo Fisher, mouse). The following day ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse Alexa488 (Invitrogen) and anti-rabbit CY3 (Dianova)-conjugated secondary antibodies were diluted 1:600 ...
-
bioRxiv - Immunology 2020Quote: ... then anti-mouse (Invitrogen) or anti-human (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse V5 (Invitrogen V8012), sheep Scp105R (from Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-mouse IgG2a (ThermoFisher)] diluted 1:1000 for 1hr at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-GAPDH (ThermoFisher) was used at 1:10,000 final dilution ...