Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 6 Cyano imidazo 1 2 a pyridine 2 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... slides were counterstained for 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, R37606) for 5-10 mins before mounting ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and 10% Hi-FBS (Thermo Fisher Scientific). BSC-1 cells (ATTC ...
-
bioRxiv - Biochemistry 2021Quote: ... Enzyme assays were conducted in 0.5 mL containing 50 mM 2-(N-morpholino)ethanesulfonic acid (pH 6) and various concentrations of soluble starch (Acros Organics, No. AC424495000, Morris Plains, NJ). The assays also included 100 mM KCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... The samples were loaded in loading buffer (2% MeCN, 0.05% trifluoroacetic acid) and bound to an Acclaim Pepmap 100 µm × 2 cm trap (Thermo Fisher Scientific), and washed for 10 min to waste ...
-
bioRxiv - Immunology 2024Quote: ... Digestion was stopped by adding acetonitrile to 2% and trifluoroacetic acid to 0.3% and the beads were collected with DynaMag-2 Magnet (Thermo Fisher Scientific). Digested peptides were purified by loading the supernatant into C18 StageTips (58) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Fluorescent stains (TOTO-1 iodide; 1 μM, Life Technologies, and ethidium homodimer-2 (EthHD-2); 1 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 6 μg of pcDNA-SARS-CoV-2-S(ΔC19) in 1 ml of Opti-MEM medium (ThermoFisher). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Microbiology 2024Quote: ... the cell nucleus was stained with 1:1000 DAPI (4’,6’-diamidino-2-phenylindole; Invitrogen; Catalog No: D1306) nuclear stain for 10 minutes at RT ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... 2 μL forward primer and 2 μL reverse primer (Invitrogen; Table 1), 14.2 μL water (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 antigens were coupled to magnetic Luminex beads (Luminex Corp) by carbodiimide-NHS ester-coupling (Thermo Fisher). Coupled beads were incubated for 2 hours at 37°C with serum samples (1:10 dilution ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 antigens were coupled to magnetic Luminex beads (Luminex Corp) by carbodiimide-NHS ester-coupling (Thermo Fisher). Coupled beads were incubated for 2 hours at 37°C with serum samples (1:10 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 60 WT and MafAS64F/+ islets from at least 6 female and male mice were analyzed with the ratiometric calcium indicator fura-2-acetoxymethylester (Fura-2 AM) (Life Technologies). Islets were maintained in 5 mM glucose for 30 min prior to measuring 11 mM glucose-induced calcium oscillations and depolarization-activated calcium influx with 30 mM KCl ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was then heated to 55 °C and held for 45 min before purification using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Biochemistry 2023Quote: ... in pyridine (CAS#25104, Thermo scientific, Rockford, IL) and stirred at 90 ° C for 1.5 hours ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... Organic acids were separated using an IonPac AS11-HC (2 mm, Thermo Scientific) column connected to an ICS-5000 system (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM L-Glutamine and 0.1 mM non-essential amino acids (ThermoFisher Scientific).
-
bioRxiv - Immunology 2021Quote: Acid-washed 2 or 5μm boroscilicate glass beads (Duke Standards, Thermo Scientific, 9005) or 15mm glass coverslips/matteks were sequentially coated with poly-L-lysine ...
-
bioRxiv - Biochemistry 2022Quote: ... Final protein concentration was assessed using 5,5-dithio-bis-(2-nitrobenzoic acid) (ThermoFisher) and a standard curve of glutathione (Aitken & Learmonth ...
-
bioRxiv - Genetics 2022Quote: ... 2% B-27 supplement without retinoic acid (Fisher Scientific, Cat #: 12-587-010), and 1% antibiotic/antimycotic (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gels were run using 2-(N-morpholino)ethanesulfonic acid (MES) buffer (Invitrogen NP000202) and transferred onto nitrocellulose transfer membrane using an XCell II Blot Module or iBlot Dry Blotting System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM Hepes and 0.1 mM non-essential amino acids (NEAA, all Gibco). 5×105 MC38OVA cells were subcutaneously (s.c. ...
-
bioRxiv - Genomics 2023Quote: ... 2-propanol and formic acid were from Fisher Scientific (Fair Lawn, NJ, USA). Ammonium formate for mass spectrometry and toluene of analytical standard quality were from Sigma-Aldrich (Sigma Chemical Co. ...
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... and 2 mM Ethylene Diamine Tetra-acetic Acid (EDTA, Invitrogen, Cergy Pontoise, France). CD8+ and CD4+ T cells were purified by positive selecting using CD8 and CD4 microbeads ...
-
bioRxiv - Molecular Biology 2024Quote: ... and reconstituted in buffer A (2% acetonitrile, 0.2% formic acid; Thermo Fisher Scientific) for mass spectrometry analysis.
-
bioRxiv - Cell Biology 2020Quote: ... Gel pieces were incubated in Elution buffer (1% formic acid, 2% acetonitrile in LC-MS grade water (Thermo Scientific)) and dried in a SpeedVac ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was then run on a Native PAGE gel and visualized with Alcian Blue (1:20 dilution of 1.25% stock solution in 2% acetic acid) followed by Silver Staining (ThermoFisher) following manufacturer protocols and imaged on the Bio-Rad Chemidoc MP Imaging System.