Labshake search
Citations for Thermo Fisher :
5201 - 5250 of 10000+ citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 555-conjugated secondary antibody (4 μg/mL; Thermo Fisher Scientific). Nuclei were counterstained with Hoechst 33342 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... DPCs were resolved via 4-12% Bis-Tris gels (Invitrogen) prerun in MES SDS running buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... and running on NuPAGE 4–12 % Bis-Tris gels (Invitrogen). Following gel transfer onto nitrocellulose (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... separated on a 4–12% NuPage Bis-Tris gel (Invitrogen) and transferred to nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells then were fixed with 4% paraformaldehyde (ThermoFisher, # J19943-K2) followed by 0.1% tritonX-100 and stained with primary antibodies used against ...
-
bioRxiv - Neuroscience 2022Quote: ... Di Sodium Hydrogen O-phosphate (Fisher Scientific- 7558-79-4); Sodium Hydrogen carbonate (Fisher Scientific- 144-55-8) ...
-
bioRxiv - Neuroscience 2022Quote: ... membrane-permeable fluorescent dye Fluo-4-AM (Thermo Fisher Scientific) dissolved in recording buffer (135 mM NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed in 4% PFA (Thermo Fisher Scientific, 28906) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... IL-4 cytokine was quantified using a kit (Thermo Fisher) following supplier’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... 4-16% NativePAGE™ gels (Life Technologies, Carlsbad, CA, USA) were used for the protein separation ...
-
bioRxiv - Cell Biology 2022Quote: ... separated on NuPAGE 4-12% Bis-Tris gels (ThermoFisher Scientific) and detected by phosphorimaging using a Typhoon scanner (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2022Quote: Sectioned tissue slides were fixed briefly in 4% paraformaldehyde (Affymetrix), dried and stored ...
-
bioRxiv - Neuroscience 2021Quote: ... F4/80 (clone BM-8, eFluor450, 4 µg/ml, Invitrogen), CD11c (clone N418 ...
-
bioRxiv - Microbiology 2020Quote: ... cell membranes were stained with 4% FM4-64 (Thermofisher Scientific). In Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... resolved on 4-12% gradient NuPAGE Bis-Tris gels (Thermofisher), transferred onto nitrocellulose membranes and detected by immunoblot using the following primary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... resolved on a NUPAGE 4-12% Bis-Tris gel (Invitrogen), and transferred onto a PVDF membrane (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... or 4 mg/L ciprofloxacin (Acros Organics, New Jersey, USA), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were loaded onto a 4-12% gradient gel (Invitrogen) and blotted onto a PVDF or nitrocellulose membrane (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: siSLX4-4 (CAGATCTCAGAAATCTTCATCCAAA) is a Stealth siRNA synthetized from Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... loaded onto 4-12% Bis-Tris gels (Novex; Life Technologies) for electrophoresis and then transferred to nitrocellulose membranes for incubation with primary antibodies and secondary antibodies ...
-
bioRxiv - Biophysics 2020Quote: ... Analyze eluate by SDS-PAGE 4-12% Invitrogen (Invitrogen, NP0321PK2). Fabs as two bands run around 30 kDa in reducing conditions ...
-
bioRxiv - Microbiology 2021Quote: ... or 4 μg/ml colistin sulfate (Fisher Scientific, cat#AAJ6091503). Following overnight selection of plates at 37°C resistant colonies were collected as slurries and plasmids extracted and purified as above ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were fixed in 4% methanol-free paraformaldehyde (Fisher Scientific) and permeabilized with 0.2% Triton X-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were loaded with 2.5 µM Fluo-4 AM (ThermoFisher) at 37°C for 15 min in complete medium and subsequently washed and incubated in imaging buffer (medium containing 10 mM HEPES ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were fixed in 4% paraformaldehyde (PFA; Thermo Fisher Scientific) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... fixed with 4% formaldehyde solution (Thermo Scientific, Rockford, IL, USA) for 10 min at room temperature and incubated either with anti-S100A (1:400 ...
-
bioRxiv - Neuroscience 2022Quote: Cells were washed three times with 4°C PBS (Gibco) containing 1 mM EGTA and 1 mM EDTA then lysed in RIPA buffer (100 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... 4-12% Bolt Bis-Tris Plus SDS gels (Thermo Scientific) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... mRNA concentration was quantified using a Qubit 4 fluorometer (ThermoFisher) and RNA Broad Range assay kit (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and the concentration was measured with Qubit 4 (Thermo Fisher). 10 ng of the ligated product was transformed into 50 μl of NEB Stable Competent cells (C3040I ...
-
bioRxiv - Neuroscience 2022Quote: ... separated using a NuPAGE 4-12% Bis-Tris gel (Invitrogen), stained with InstantBlue (Abcam ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 wells of a 96 well Maxisorp microtiter plate (NUNC) were coated with 100 µl of 2 µM GST-tagged GTPγS-loaded HRas in dialysis buffer (150 mM NaCl ...
-
bioRxiv - Physiology 2020Quote: ... Supernatants were electrophoresed on a 4–12% polyacrylamide gel (Invitrogen), and proteins were transferred to a HyBond PVDF membrane (Amersham) ...
-
bioRxiv - Neuroscience 2019Quote: ... and then separated on 4–12% NuPAGE Novex gels (Invitrogen). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... separated in NuPAGE 4% - 12% Bis-Tris protein gels (ThermoFisher), and analyzed by coomassie blue staining ...
-
bioRxiv - Microbiology 2019Quote: ... Fluo-4 AM were purchased from Invitrogen (Eugene, Oregon, USA). The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with 4 μL of First-Strand Reaction Buffer (Invitrogen), 2 μL of 0.1 M DTT ...
-
bioRxiv - Physiology 2020Quote: ... cells were fixed in 4% paraformaldehyde (PFA, Thermo Fisher Scientific) for 10 min and permeabilized with 0.1% Triton X-100 in PBS for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... for 45 minutes or Fluo-4 AM (Invitrogen Cat# F14201) for 25 minutes at 37 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 4 μL of SBA-AlexaFluor™ 594 (Invitrogen, 32462). Antibody and SBA were incubated with extract in the dark with agitation overnight at 4 °C prior to SEC.
-
bioRxiv - Neuroscience 2019Quote: Cultures were fixed in 4% formaldehyde (Fisher scientific, MA, USA) – 4% sucrose (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... Pre-cast 4-12% NuPage Novex Bis-Tris gels (Invitrogen) were assembled in a XCell vertical electrophoresis unit (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... Protein lysates were separated using 4-12% SDS-PAGE (Invitrogen) and transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... which was then ligated into the pENTR-4 vector (Invitrogen) at NcoI/XhoI sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded on 4–12% Bis-Tris (Thermo Fisher Scientific) or 3–8%Tris-Acetate (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were resolved on a NuPAGE 4-12% gels (Invitrogen) and transferred onto polyvinylidene fluoride membrane (EMD Millipore) ...
-
bioRxiv - Physiology 2020Quote: ... Cells were loaded with 500 nM fluo 4-AM (Invitrogen) for 1 h in the dark ...
-
bioRxiv - Biophysics 2020Quote: ... NuPAGE© gels (4-12% - Thermo Fisher Scientific Cat# NP0321) were transferred to Immobilon© P PVDF membranes (Millipore-Sigma Cat# IPVH00010 ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in fresh 4% paraformaldehyde in PBS (Gibco; pH 7.4) for 24 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: Ninety-six well plates (Immulon 4 HBX; Thermo Fisher Scientific) were coated with recombinant RBD at a concentration of 2 ug/ml with 50μl/well overnight ...