Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 6 FLUORO THIOCHROMAN 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... no UNG (Life Technologies, Quant Studio 6). Reactions were carried out for 40 cycles ...
-
bioRxiv - Genomics 2023Quote: ... using a QuantStudio 6 FLEX machine (Thermofisher). See Supplementary Data for primers ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well plates (Thermo Fisher Scientific). Each line was passaged with 0.5 mM EDTA (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... on a QuantStudio 6 Pro (Applied Biosystems). All data were normalized by 18S rRNA transcript and calculated using the ΔΔCq method ...
-
bioRxiv - Biochemistry 2024Quote: ... or 6 µM blasticidin-S (Invitrogen, R21001), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1:10000 in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 μl Lipofectamine 2000 (Life Technologies, # 11668) were mixed with 0.15 ml Opti-MEM ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-6 (cat#: 200-06; Fisher Scientific). All ligands were used at a concentration of 100 ng/mL.
-
bioRxiv - Plant Biology 2024Quote: ... on a QuantStudio 6 Flex (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... Novex TBE 6 or 10% gels (Invitrogen) were pre-run in 0.5x TBE running buffer (pH ∼8.4 +/-0.5) ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 300,000/6-well) and IDC (5,000/96-well; 100,000/6-well) cells were seeded in regular (Thermo Fisher Scientific) or ULA (Corning Life Sciences ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Supernatant obtained from the BALF was used to measure the endogenous release of IL-6 using a commercially available Murine IL-6 ELISA kit according to the manufacturer’s instructions (ThermoFisher, InVItrogen). The absorbance was read at 450 nm and secreted IL-6 was analyzed using Gen5 data analysis software (BioTek Instruments ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs were forward transfected in 6-well dishes by using 6 μl of FuGENE® HD (PRE2311, Fisher Scientific) with 3 μg of sgRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... for the first 24 hours and for further 4 to 6 days in Essential 6 media (Thermo Fisher Scientific).
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Cell Biology 2020Quote: Cells in the 6-well plates were transfected with 2μg plasmid of AMPKα or OGG1 via 6 μl Lipofectamine 2000 (Invitrogen) for 6 hours following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The Cas9-sgRNA-containing plasmid and donor vector were co-transfected at a molar ratio of 1:6 into XX mESCs cells on a 6-well plate using Lipofectamine 2000 according to the manufacturer’s protocol (ThermoFisher). Transfected cells were passaged at different densities into three Petri dishes with feeders ...
-
bioRxiv - Biochemistry 2021Quote: ... 6% native PAGE gels were prepared by first making a gel solution containing 6% acrylamide (29:1) (Fisher Scientific).15 This solution was then degassed under vacuum and mixing ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).