Labshake search
Citations for Cell Signaling Technology :
1 - 28 of 28 citations for H2 Q10 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 1-mM CaCL2 in H2 O) supplemented with 1:100 protease/phosphatase inhibitor cocktail (Cell Signaling). The protein content was measured using a Pierce BCA assay kit (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble siRNA (Cell Signaling) was used as control ...
-
bioRxiv - Systems Biology 2020Quote: ... Figure S5 shows the knockdown efficiency of siRNA transfections in each cell line with GAPDH siRNA compared to no siRNA (just N-TER transfection reagent) and negative control siRNA by Western blot (GAPDH antibody: Cell Signaling Technology, Cat#2118 ...
-
bioRxiv - Biochemistry 2023Quote: Prevalidated human-specific MLL2 small-interfering RNA (Silencer® MLL2 siRNA #AM16708) and control siRNA (SignalSilence® Control siRNA#6568) were purchased from Cell Signaling Technology. TERF2IP siRNA and TRF2 siRNA were designed and ordered from GeneCust (Boynes France) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following siRNAs were used for functional assays: siRNA FYN#1 (Cell Signaling Technology #12473), siRNA FYN#2 5’GGCCCTTTATGACTATGAATT3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... with siRNA against Atg7 (50nM, Cell Signaling). Scramble siRNA (Cell Signaling ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ERK1 siRNA (Cell Signaling Technology, #6436), ERK2 siRNA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... and negative control siRNAs (Cell Signaling Technology) were transfected to cells to evaluate the effect of downregulating the expression of AP2A1 ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected with 100nM SAPK/JNK siRNA I or control siRNA (Cell Signaling Technology Inc., MA, USA) by using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: siRNAs against ERK1/2 (#6560) and AKT1/2 (#6211) and SignalSilence control siRNA (#6568) were purchased from Cell Signaling Technology and were used at 10 µM ...
-
bioRxiv - Cancer Biology 2020Quote: ... Rb siRNA was purchased from Cell Signaling Technology.
-
bioRxiv - Microbiology 2022Quote: ... SignalSilence® FoxO1 siRNA I (Cell Signaling TechCat # 6302). RNA was extracted from HFF at indicated time points using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... the mouse specific Smad4 siRNA (Cat.12791; Cell Signaling) and the Signal Silence Control siRNA (Cat.6568S ...
-
bioRxiv - Cell Biology 2022Quote: siRNAs for PARP1 (#6304) were purchased from Cell Signaling Technology Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipofection with scrambled siRNA and p53si RNA (Cell Signaling Technology) was performed approximately 24 h after cell plating using Effectene Transfection Reagent (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... SignalSilence® FoxO1 siRNA I (Cell Signaling Tech, Cat# 6242), SignalSilence® FoxO1 siRNA I (Cell Signaling TechCat # 6302) ...
-
bioRxiv - Molecular Biology 2023Quote: ... SET8 siRNA sequence was provided and validated by Cell Signaling (#1307). The other validated siRNA sequences were provided by Sigma-Aldrich (MISSION® esiRNA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... p38 siRNA were bought from Cell Signaling Technology (Denver, Massachusetts, USA). Transwell insert plates were taken from ThermoFisher Scientific and matrigel from Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA for mTOR (catalog #6381S) was obtained from Cell Signaling Technology (Danvers, MA). ON-TARGET Plus non-targeting pool (Catalog # D-001810 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Signal Silence Control siRNA (Cat.6568S; Cell Signaling, Danvers, MA, USA) were used ...
-
bioRxiv - Molecular Biology 2019Quote: Differentiated THP-1 cells were transfected with siRNA (Cell Signaling Technology, Danvers, Massachusetts, USA) using jetPrime PolyPlus transfection reagent (Thermofischer Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... The SignalSilence p70/85 S6 Kinase siRNA was from Cell Signaling (MA, United States). The plasmids for FUCCI live cell imaging ...
-
bioRxiv - Cancer Biology 2021Quote: ... and SignalSilence® p53 siRNA I (#6231) were purchased from Cell Signaling Technology (Danvers, MA, USA). DCFDA/H2DCFDA – cellular ROS assay kits (ab113851 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Signal Silence ® P44/42 MAPK (ERK1/2) siRNA was obtained from Cell Signaling Technology (Danvers, MA, USA). The rat DDR2/CD167b Gene ORF cDNA clone expression plasmid was obtained from Sino Biologicals (Beijing ...
-
bioRxiv - Immunology 2020Quote: BMDMs with 80% confluence were transfected with either scrambled or two different concentrations of SAA3 siRNA (Cell Signaling Technology) using Lipofectamine RNAiMAX reagent (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The efficiency of siRNA knockdown was verified by immunoblotting of whole cell lysates with an anti-E-cadherin (24E10, Cell signaling) antibody.
-
bioRxiv - Cancer Biology 2020Quote: Chromatin immunoprecipitation was performed as described previously (52) 72 hours after transfection with control or RNF40 siRNAs using antibodies against H2Bub1 (Cat. No. 5546S, Cell Signaling Technology) and H3K4me3 (Cat ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... was purchased from Integrated DNA Technologies (IDT, Coralville, IA) and a previously described Rheb siRNA (Menon et al., 2014) was purchased from Cell Signaling Technology (#14267, CST, Danvers, MA). Drugs utilized in this study ...