Labshake search
Citations for Jena Bioscience :
1 - 33 of 33 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... -MH and -M were amplified by PCR using Pfu-X DNA polymerase (Jena Bioscience, Germany) according to the following program ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic polymerase chain reaction (PCR) was performed using Taq Polymerase (Jena Bioscience) with the primers listed in S2 Table ...
-
bioRxiv - Developmental Biology 2023Quote: ... using yeast poly(A) polymerase (Jena Bioscience). The protein-RNA complexes were then labelled with IRDye800-DBCO (LiCor) ...
-
bioRxiv - Microbiology 2021Quote: ... Bst 2.0 polymerase buffer (2 μl) (Jena Bioscience). The incubation temperature was varied from 60-65°C for 60 min ...
-
bioRxiv - Microbiology 2021Quote: ... 0.32 units/ μl sapphire Bst 2.0 polymerase (Jena Bioscience), Bst 2.0 polymerase buffer (2 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then treatment with yeast poly(A) polymerase (Jena Bioscience). The RNA was further 3’-end-labeled with azide-dUTP (TriLink biotechnologies ...
-
bioRxiv - Microbiology 2023Quote: ... Polymerases-RNA mixes were then incubated with immobilized γ-Aminophenyl-m7GTP (C10-spacer) beads (Jena Bioscience) for 2h at 4 degrees ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subjected to IVT reactions using 50 ng/μl T7 RNA polymerase HC (EP0113, Jena Bioscience), with equimolar ratios of all natural ribonucleotides ...
-
bioRxiv - Microbiology 2020Quote: ... A DNA sequencing ladder was generated using a DNA cycle Sequencing Kit (Jena Bioscience) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Unmodified yeast tRNAPhe was prepared by standard in vitro transcription with T7 polymerase with unlabelled NTPs (Jena Bioscience) for unlabelled samples or 15N-labelled UTP and GTP (Eurisotop ...
-
bioRxiv - Biophysics 2019Quote: Functionalised DNA handles of approximately 600 bp length were amplified from λ -DNA (e.g. Jena Bioscience) using the a triple biotinylated primer ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and then used as templates for in vitro dsRNA synthesis performed by T7 RNA Polymerase (Jena Bioscience, Jena, Germany), according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... T4 DNA ligase was obtained from Jena Biosciences. Agarose gel electrophoresis was used to analyze PCR and restriction products ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 40 cycles of PCR with either the sense or anti-sense primer in a Taq polymerase PCR mixture to which 0.067 mM of Digoxigenin-5-aminoallyl-dUTP (Jena Bioscience GmbH, Jena, Germany) had been added and in which the concentration of dTTP had been lowered to 0.133 mM ...
-
bioRxiv - Physiology 2019Quote: ... and a 100 bp DNA ladder (Jena Bioscience, Jena, Germany) was used as a size marker.
-
bioRxiv - Molecular Biology 2022Quote: ... primer extension was performed using the DNA cycle sequencing kit (Jena Bioscience), 150 ng digested DNA and 32P-end-labelled oligonucleotides according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... A sequencing ladder was generated using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s recommendations with the CJnc230 sRNA region amplified from NCTC11168 WT (CSS-5295 ...
-
bioRxiv - Microbiology 2023Quote: ... the probe DNA was labeled with Biotin-11-UTP (Jena Bioscience, Jena, Germany) through PCR amplification using T4 DNA polymerase (Novoprotein ...
-
bioRxiv - Microbiology 2021Quote: ... A sequencing ladder was also constructed using the DNA Cycle sequencing kit (Jena Bioscience) according to the manufacturer’s instructions with the CJnc180/190 region amplified with primers CSO-0354/0355 from genomic DNA (NCTC11168 wild-type ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA oligonucleotides used as probes were extended with 5-Azido-PEG4-dCTP (Jena Bioscience) and terminal transferase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... ∼900 μL of 4 μM forked DNA duplex and 100 μM ATPγS (Jena Bioscience, #NU-406-50) in Buffer S was applied to the column at 0.05 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA from each clone was labeled through nick translation with either the Atto550 NT Labeling Kit (Jena Bioscience) or the Digoxigenin NT Labeling Kit (Jena Bioscience) ...
-
Tracking of quiescence in Leishmania by quantifying the expression of GFP in the ribosomal DNA locusbioRxiv - Microbiology 2019Quote: GFP was integrated within the 18S ribosomal DNA locus with the use of the pLEXSY-neo2 system (Jena Bioscience) as previously reported elsewhere (19) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...
-
bioRxiv - Microbiology 2020Quote: ... denatured for 3 min at 90°C and subjected to separation using a denaturing 8% sequencing gel in presence of a RyeG-specific sequencing ladder prepared using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Simultaneous in situ hybridization included Nick-translation labelled genomic DNA from barley (AF594 NT Labeling Kit, PP-305L-AF594, Jena Bioscience) and the TRS-probe (AF488 NT Labeling Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... short oligo DNAs for each target (see Supplementary Table 6) were pooled and labelled with 5-Propargylamino-ddUTP-Cy3 or -Cy5 (Jena Biosciences) using the Terminal Deoxynucleotidyl Transferase (Thermo Fisher)52 ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products and plasmid DNAs were labeled with ATTO488-dUTP or ATTO550-dUTP using Fluorescent Nick Translation Labeling kits (Jena Bioscience, Germany).
-
bioRxiv - Plant Biology 2023Quote: ... Probes specific for 45S ribosomal DNA were amplified using specific primers (Ohmido and Fukui, 1995) and directly labeled with aminoallyl-dUTP-CY5 (Jena Biosciences, Jena, Germany).
-
bioRxiv - Genetics 2023Quote: ... The probes were obtained by direct labeling of the bacterial DNA (1.5 μg) using the Nick Translation kit from Jena Bioscience (Atto488 NT Labeling Kit), the labeling reaction was performed at 15°C for 90 min ...
-
bioRxiv - Genomics 2023Quote: ... mycoides probe was obtained by direct labeling of the bacterial DNA (1.5 µg) using the Nick Translation kit from Jena Bioscience (Atto488 NT Labeling Kit). For the 2µ plasmid labeling ...