Labshake search
Citations for Beckman :
1 - 50 of 889 citations for rno mir 194 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 E7335S, Index Primers Set 2, E7500S) with Agencourt AMPure XP magnetic beads (Beckman coulter A63881) exactly as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 region of 16S rRNA gene was amplified using the universal primer set 515F and 806R.27 PCR products were cleaned up with an AMPure XP kit (Beckman Coulter, CA), followed by electrophoresis on 0.7% agarose gel and 1.15% Synergel (Diversified Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... Surplus PCR primers were further removed by purification using SPRIselect beads (Beckman-Coulter ...
-
bioRxiv - Genomics 2020Quote: ... RT-PCR products were cleaned with AMPure XP beads (Beckman Coulter A63880). Next ...
-
bioRxiv - Immunology 2022Quote: ... GEM-RT products were subsequently amplified using human BCR primers and cleaned up through SPRIselect beads (Beckman Coulter). Next ...
-
bioRxiv - Genomics 2020Quote: ... PCR primer and small amplicons were removed by Agencourt XP bead purification (Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with NEBNext Multiplex Oligos for Illumina® (Dual Index Primers Set 1) and AMPure XP magnetic beads (Beckman Coulter, Brea, CA, USA). DNA content and quality of indexed libraries were examined with a Qubit 4.0 using the high-sensitivity kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... including library amplification for 15 PCR cycles using custom indexed primers and post-PCR clean-up with 0.85x volume Ampure XP (Beckman Coulter). Libraries were quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: Primers were removed after the second PCR step with AMPure XP Reagent (Beckman #A63882). Library was quantified (QuantiFluor® dsDNA System ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Surplus PCR primers were further removed by purification using SPRIselect beads (Beckman-Coulter, Villepinte, France) and the final libraries were checked for quality and quantified using capillary electrophoresis.
-
bioRxiv - Developmental Biology 2022Quote: ... The RT product was PCR amplified and size selected using Agencourt AMPure beads (Beckman Coulter), then checked for quality and size on the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT-PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter, CA, USA) and then analyzed by using the Agilent Tapestation 4200 System and High Sensitivity DNA D5000 kit (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Surplus PCR primers were further removed by purification using SPRI select beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Genomics 2021Quote: ... Surplus PCR primers were further removed by purification using SPRI-select beads (Beckman-Coulter, Villepinte, France) and the final libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR primers were removed with 1x 0.9:1 SPRI beads (Beckman Coulter, Cat no. A63880) according to manufacturer’s instructions and samples eluted in 20μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified using PCR Primer II A and subsequently purified using Ampure XP beads (Beckman). Illumina libraries were prepared using Nextera XT DNA library preparation kits (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Cancer Biology 2024Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... to purify the RT-PCR products which were further cleaned by AMPure XP beads (Beckman Coulter) before ligation to plasmid using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2) first-round PCRs were set up using a Biomek FX liquid handling system with a 96- well head (Beckman Coulter); 3 ...
-
bioRxiv - Genomics 2021Quote: ... the PCR product is pooled and purified with 1x AMPure XP beads to remove primers (Beckman Coulter A63881). Pooling ratios of PCR1 products were empirically determined (Supplemental Figure 4D ...
-
bioRxiv - Genomics 2021Quote: ... the PCR product is pooled and purified with 0.8x AMPure XP beads to remove primers (Beckman Coulter A63881). Pooling ratios of PCR1 products were empirically determined (Supplemental Figure 4 ...
-
bioRxiv - Microbiology 2022Quote: ... Adapter-ligated fragments were PCR amplified using indexing primers followed by purification using Agencourt XP beads (Beckman Coulter). The library electropherograms were assessed using an Agilent Bioanalyzer 2100 and Agilent DNA 1000 kit ...
-
bioRxiv - Cell Biology 2019Quote: ... Adapter ligated fragments were PCR amplified using indexing primers followed by purification using the Agencourt XP beads (Beckman Coulter). The library electropherograms were assessed using Agilent Bioanalyzer 2100 and Agilent DNA 1000 kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The library fragments of ∼350 bp (insert plus adaptor and PCR primer sequences) were selected and isolated with Agencourt AMPure XP beads (Beckman). Library DNA was sequenced on an Illumina HiSeq X Ten platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR products of 100−1,000 bp (including adaptor and primer sequences) were purified using AMPure XP beads (Beckman Coulter) and captured on an Illumina flow cell ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The P2-ligated DNA was then amplified for 12 rounds of PCR using custom RAD primers (Hohenlohe et al., 2012) and cleaned with 0.8X AMPure XP beads (Beckman Coulter). The final libraries were sequenced either on an Illumina HiSeq 4000 or an Illumina NovaSeq 6000 to generate 2×150 bp reads (Table S3).
-
bioRxiv - Cancer Biology 2024Quote: ... Each ATAC library was amplified with Nextera primers for 16 PCR cycles and purified with Agencourt AMPure XP (Beckman Coulter) to remove excess primers ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... acceleration was set at Max and deceleration was set at Coast (no brake) setting (Beckman Coulter-Optima XPN 100 ultracentrifuge). Ribosome pellets were resuspended in 750 μL of resuspension buffer (20 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified DNA was purified using a Qiagen MinElute PCR Purification Kit and primer dimers (<100 bp) were removed using AMPure beads (Beckman Coulter). ATAC-Seq was performed with two biological repeats to ensure the robustness of the data sets ...
-
bioRxiv - Genomics 2024Quote: ... c) increasing PCR cycles (15 in total) and eliminating primer dimers prior to sequencing (Agencourt AMPure XP magnetic beads, Beckman Coulter). Primary PDAC were sequenced on the NovaSeq6000 ...
-
bioRxiv - Neuroscience 2020Quote: ... we generated double-stranded DNA template for transcription of each sgRNA via a template-free polymerase chain reaction (PCR) with partially overlapping primers (IDT, PAGE purified) and purified the product with Ampure XP beads (Beckman Coulter, A63880). We then transcribed sgRNAs in vitro using the MEGAscript T7 Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We performed a PCR product cleanup step to remove primers and small DNA products using Agencourt AMPure XP Beads (Beckman Coulter B37419AB) or spin columns (Qiagen 28104) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 μL reactions were prepared by dispensing 1 μL of each 10 μM reverse primer into the wells of a 96-well PCR plate using the Echo liquid handler (Beckman Coulter, Brea, CA). A mastermix consisting of polymerase premix ...
-
bioRxiv - Genomics 2024Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (SPRIselect beads for TT-seq and Frac-seq) (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Genomics 2019Quote: ... We then conducted a PCR purification step aimed at removing primer dimer and unincorporated dNTPs using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA) at a 1:1 ratio (50 μL PCR product ...
-
bioRxiv - Microbiology 2019Quote: ... Each PCR amplicon was cleaned twice to remove the primers and short DNA fragments using the Agencourt AMPure XP system (Beckman Coulter, Inc., Brea, CA, USA) and quantified using a Qubit Fluorometer (Invitrogen Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... Each PCR amplicon was cleaned twice to remove the primers and short DNA fragments using the Agencourt AMPure XP system (Beckman Coulter, Inc., Brea, CA, USA) and quantified using a Qubit Fluorometer (Invitrogen Corporation ...
-
bioRxiv - Microbiology 2024Quote: The resulting amplicons were then cleaned of free primers and primer dimer species using AMPure XP beads (Beckman Coulter). Sequencing libraries were prepared using the Nextera XT library preparation kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.9) were set up in 14 × 95 mm tubes (Beckman Coulter). 166 μl reactions were assembled as described previously for Benzonase-treated affinity pull-down assay ...
-
bioRxiv - Microbiology 2019Quote: ... The removal of primer excess and primer dimers was done by the Agencourt AMPure XP RNA Clean beads (Beckman Coulter, Brea, California). The amount of sample was assessed by Qubit HS DNA assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library primer dimers were removed by AMPureXP beads (Beckman). Quality control was assessed by Bioanalyzer high sensitivity assay (Agilent) ...
-
bioRxiv - Genomics 2020Quote: ... Primers were removed using AMpure XP beads (Beckman Coulter) and the resulting library was sequenced paired ends and 150bp in the HiSeq 4000 platform.
-
bioRxiv - Molecular Biology 2020Quote: ... Primers were removed using SPRIselect beads (Beckman Coulter, B23317). A second round of PCR was performed using the initial PCR library as a template ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library primer dimers were removed by AMPureXP beads (Beckman). Quality control was assessed by bioanalyzer high sensitivity assay (Agilent) ...
-
bioRxiv - Genomics 2020Quote: ... primers were removed using AMpure XP beads (Beckman Coulter #A63881) prior to 2×50bp paired-end sequencing.