Labshake search
Citations for Beckman :
1 - 50 of 1577 citations for Rat Wide range C Peptide CP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: The ACCESS SARS-CoV-2 CLIA (Beckman Coulter Inc., California, USA) was used for semiquantitative detection of IgG directed against S protein RBD using serum obtained from venipuncture blood ...
-
bioRxiv - Bioengineering 2021Quote: ... and platelets were counted by a Hematology Analyzer (Beckman Coulter Act Diff 5 CP) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum 17β-estradiol levels in female rats and serum testosterone levels in male rats were assayed using commercially available radioimmunoassay (RIA) kits from Beckman Coulter (Brea ...
-
bioRxiv - Biochemistry 2021Quote: ... The labeled peptides were further purified by C-18 (5 μm, 4.6 mm × 150 mm, Beckman Coulter Inc.) reverse phase-high performance liquid chromatography ...
-
bioRxiv - Developmental Biology 2023Quote: ... Peptide supernatant was cleared by ultracentrifugation at 100,000□g for 1 hour at 4□°C (Beckman Coulter, 343775), then vacuum-dried overnight.
-
bioRxiv - Microbiology 2019Quote: ... The cDNA pool was size fractionated in the size range of 200 to 600 bp using a differential cleanup with the Agencourt AMPure kit (Beckman Coulter Genomics). Aliquots of the cDNA pools were analyzed by capillary electrophoresis (Shimadzu MultiNA microchip) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... On several occasions we calibrated the aperture using 5.037-µm diameter wide latex beads (Beckman). The measured variance in bead size was below the recommended threshold of 2.0% at each calibration.
-
bioRxiv - Genetics 2020Quote: ... HS rat DNA was extracted from spleen tissue using the Agencourt DNAdvance Kit (Beckman Coulter Life Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: Sorting of Sca-1 and c-Kit double positive population by Beckman Coulter MoFlo Astrios EQ Cell Sorter shown in the dotted shade box is considered optional ...
-
bioRxiv - Systems Biology 2024Quote: ... amplified libraries were size selected for a range of 400-800 bp using SPRIselect beads (Beckman Coulter). NGS was performed on an Illumina NextSeq550 or llumina HiSeq 2500 sequencer according to the manufacturers’ protocols with custom first-read primer (1:1 mix of GAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA and TGAGTGATTGACTACCCACGACGGGGGTCTTTCA).
-
bioRxiv - Biochemistry 2019Quote: ... low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) using commercially-available kits (Beckman-Coulter, CITY, STATE, USA). Serum insulin concentration was determined using an electrochemiluminescence-based assay (Immulite 2000 ...
-
bioRxiv - Immunology 2020Quote: ... genome-wide sequencing using a standard SPRI50 library preparation was performed on the SA challenged neutrophils with AMPure XP from Beckman Coulter.
-
bioRxiv - Immunology 2020Quote: ... The library DNA within the 150-to 500-bp range was enriched by AMPure XP beads (Beckman Coulter), quantified by NEBNext Library Quant Kit (NEB) ...
-
bioRxiv - Pathology 2024Quote: RNA from rat liver tissue was snap frozen in RNAlater and lysed using lysis buffer (RNAdvanced Kit, A32646, Beckman Coulter), 20µL Proteinase K on a TissueLyser II (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... after which the fragmented DNA was size-selected within a 300-600 bp range using AMPure XP beads (Beckman Coulter). The size-selected pools were then end-repaired and A-tailed ...
-
bioRxiv - Microbiology 2024Quote: ... horseradish peroxidase-conjugated anti-rat IgG (Beckman Coulter), or horseradish peroxidase-conjugated anti-mouse IgG (CST ...
-
bioRxiv - Cancer Biology 2019Quote: ... held at 4 °C) and then cleaned up with the SPRIselect Reagent Kit (Beckman Coulter). A qualitative analysis on the amplified cDNA was performed using Agilent Bioanalyzer high sensitivity chip.
-
bioRxiv - Microbiology 2020Quote: ... and fragments within a size range of 200 - 700 bp were size-selected using the SPRIselect beads (Beckman Coulter, Brea, CA). In the amplicon library ...
-
bioRxiv - Biophysics 2023Quote: ... Subsequent ATPase and Ca2+-transport CRC assay plates (0-50 μM compound range) with repurchased compounds were made in a similar manner using with the Echo 550 (Beckman Coulter) using either 384 well transparent plates (Greiner Bio-One ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 °C (Beckman Coulter Optima MAX-XP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 °C (Beckman Coulter Optima MAX-XP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The percentage of cells within a defined range of fluorescence intensity was determined with Beckman Coulter CyAn ADP flow cytometer (Beckman Coulter, United States).
-
bioRxiv - Neuroscience 2020Quote: ... to obtain fragments in the size range of 150 bp followed by purification with AMPure XP beads (×1.8v/v) (Beckman Coulter A63881, Indianapolis, IN). Purified DNA was resuspended in 45 μl elution buffer ...
-
bioRxiv - Biophysics 2020Quote: ... and the flour had a mean particle size in the range 450∼550 µm as measured by a LS13320XR laser diffraction particle size analyzer (Beckman Coulter, Inc., USA). The effect of High-hydrostatic pressure (HHP ...
-
bioRxiv - Cell Biology 2019Quote: ... The library fragments with a size range of 100-200 bp were selected with Agencourt AMPure XP beads (Beckman Coulter, Brea, CA, USA). Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... the SBV samples were purified via sucrose density gradient centrifugation (10–50% range) at 32,500 rpm for 4 h with an SW 41 Ti Swinging-Bucket Rotor (Beckman Coulter Inc., Brea, CA). The SBV band that corresponded to the 40% sucrose gradient was harvested and then centrifuged at 25,000 rpm for 12 h ...
-
bioRxiv - Biochemistry 2023Quote: ... products within the 200-400 bp size range were selected by solid phase reversible immobilization with the Agencourt AMPure XP reagent (Beckman Coulter, C.A., U.S.A.) and PCR amplification consisted of 12 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... secondary anti-rat Cy3 (Beckman Coulter, Ref. 712-166-153), HRP-NHS (AAT Bioquest ...
-
bioRxiv - Cell Biology 2023Quote: ... secondary anti-rat-HRP (Beckman Coulter, Ref. 712-035-153), secondary anti-rat Cy3 (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C (Beckman Coulter). The pellet containing lentiviral particles was suspended in the residual medium ...
-
bioRxiv - Genomics 2020Quote: ... 4°C (Beckman Coulter). Supernatant was loaded onto 5 ml HisTrap FF columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C (Beckman Coulter). Clarified lysates were poured several times over 0.5-1 ml Streptactin resin (IBA ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C (Beckman Coulter). The pellet containing lentiviral particles was suspended in the residual medium ...
-
bioRxiv - Microbiology 2022Quote: ... and 72h of film incubation and their absorption spectra were recorded in the 200-700 nm range through a Beckman DU 800 spectrophotometer (Beckman Coulter Life Sciences, Milan, Italy). The experiments were performed in triplicate (n = 3 ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 °C (Beckman JLA 16.2500) and then bound to 0.1 cell paste volumes of anti-FLAG resin (Sigma M2 ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 °C (Beckman JLA 8.1000), washed in pre-chilled PBS and resuspended in 20 cell paste volumes of preparation buffer (50 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2020Quote: ... 4°C (SW55Ti rotor, Beckman). The pellets were resuspended in 25% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... 4°C (VTi65.1 rotor, Beckman) with the maximum acceleration and minimum deceleration allowing for isopycnic separation of subcellular particles and membranes ...
-
bioRxiv - Biochemistry 2021Quote: ... 4°C (SW41 rotor, Beckman). The supernatant was concentrated with a 100-kDa molecular weight cutoff concentrator (Merck Millipore ...
-
bioRxiv - Plant Biology 2021Quote: ... Incorporated P33 in AMARA peptide was quantified using a liquid scintillation counter (Beckman, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... or Lin−Sca-1+c-Kit+CD150+CD48−CD34− (CD34−HSC) and Lin−Sca-1+c-Kit+ (LSK) cells were sorted on MoFlo Astrios EQ (Beckman Coulter). Quantification of CD71 ...
-
bioRxiv - Genomics 2023Quote: Rat tissues were disrupted in GenFind v2 lysis buffer (Beckman Coulter, Indianapolis, IN) with a tissue ruptor (Omni International ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4°C (Beckman Coulter Allegra X15r). After the final wash to remove Matrigel ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4°C (SW41Ti rotor, Beckman Coulter) and 16 fractions were collected ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4°C (SS34 Rotor, Beckman Coulter).
-
bioRxiv - Cell Biology 2020Quote: ... 4°C (with Beckman SW32 rotor). The pellet will contain rough microsomes and the interface between 0.25-1.3M will contain smooth microsomes ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C (Beckman Coulter F301.5 rotor) to remove large aggregates ...
-
bioRxiv - Immunology 2022Quote: ... lysed with Optilyse C (Beckman Coulter) for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C (TLA-45 Beckman rotor). The solubilized proteins were separated on 4–15 % BN-gels and analyzed by immune detection using polyclonal α-YidC antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... the C-tubes were quickly spun in a chilled (4°C) Allegra-30R centrifuge (#B08708, Beckman Coulter) with an SX4400 swinging bucket rotor to collect the samples in the bottom of the tubes ...