Labshake search
Citations for Stemcell Technologies :
1 - 50 of 246 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: CRISPR/Cas9 editing was performed with the ArciTect ribonucleoprotein (RNP) system (STEMCELL Technologies). The designed sgRNA targeted exon 2 of the NF2 gene (GTACACAATCAAGGACACAG ...
-
bioRxiv - Immunology 2023Quote: ... one piece (∼3g) was used for CD25+CD8- Treg enrichment using a custom thymic Treg selection kit (STEMCELL Technologies)102 ...
-
bioRxiv - Molecular Biology 2022Quote: H9 human ES cell lines obtained from the HMS Cell Biology Initiative for Genome Editing and Neurodegeneration were cultured using the mTeSR1TM1 kit (STEMCELL technology) and 1% penicillin-streptomycin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... B cells were enriched (Human Pan-B cell Enrichment Kit [19554, StemCell Technologies]) and then stained with viability dye FVS780 (565388 ...
-
bioRxiv - Immunology 2021Quote: Splenic B cells were isolated using a mouse B cell isolation kit (STEMCELL Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... splenic B cells were purified with a mouse B cell isolation kit (StemCell Technologies), and then stimulated with lipopolysaccharide (LPS ...
-
bioRxiv - Immunology 2022Quote: Splenic B cells isolated with EASYSEP MOUSE B cell isolation kit (Stem Cell Technologies) were cultured at 1.10^6 cells per ml in RPMI 1640 medium (Eurobio ...
-
bioRxiv - Immunology 2022Quote: Primary B cells were purified using the EasySep Mouse B Cell Isolation Kit (STEMCELL Technologies) and stimulated with anti-IgM (20µg/mL ...
-
bioRxiv - Immunology 2019Quote: ... B cells were isolated using a negative selection B cell isolation kit (Stemcell Technologies, #19854A). The A20 murine IgG+B-cell line was obtained from ATCC (#TIB-208) ...
-
bioRxiv - Immunology 2022Quote: ... All CD19+ B cells were isolated (STEMCELL Technologies EasySep Mouse B Cell Isolation kit, STEMCELL Technologies) and mRNA was extracted and purified (PureLink RNA Mini Kit ...
-
bioRxiv - Immunology 2022Quote: B cells from spleen were sorted with EASYSEP MOUSE B cell isolation kit (Stem Cell Technologies) and lysed using RIPA buffer (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: B cell isolation was performed using the the EasySep Human B Cell Isolation Kit (StemCell Technologies). PBMC were diluted in PBS supplemented with 2 % FBS and 1 mM EDTA to a final concentration of 107 cells/ml ...
-
bioRxiv - Immunology 2023Quote: ... B cells were then isolated using a human B cells enrichment kit (Stemcell Technologies, Cat#19054). Briefly ...
-
bioRxiv - Physiology 2023Quote: ... B cells were isolated via negative selection with an EasySep B cell isolation kit (STEMCELL Technologies)
-
bioRxiv - Neuroscience 2022Quote: ... 1x N2 supplement B (StemCell Technologies) and 0.3% dextrose (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2022Quote: ... 1x N2 supplement B (Stemcell Technologies), and 0.3% dextrose (D-(+)-glucose ...
-
bioRxiv - Neuroscience 2022Quote: ... 1x N2 supplement B (STEMCELL Technologies), 0.3% dextrose (D-(+)-glucose ...
-
bioRxiv - Neuroscience 2023Quote: ... 1x N2 supplement B (Stemcell Technologies), 0.3% dextrose (D-(+)-glucose ...
-
bioRxiv - Cell Biology 2023Quote: ... N2 supplement B (# 07156, StemCell Technologies), D-(+ ...
-
bioRxiv - Immunology 2019Quote: ... B cells were purified using the EasySep negative selection mouse B cell enrichment kit (Stem Cell Technologies). B cell purity was assessed by flow cytometry using anti CD19 or B220 antibodies (we routinely observed over 98% purity) ...
-
bioRxiv - Immunology 2022Quote: B cells were enriched from human PBMCs using EasySep Human Pan-B Cell Enrichment Kit (StemCell Technologies) before being incubated with Fc block (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: Pretumor splenic B cells were purified using the Mouse Pan-B Cell Isolation Kit by StemCell Technologies. Bone marrow cells were flushed from femurs and tibia ...
-
bioRxiv - Immunology 2021Quote: ... Resting B cells were isolated using the EasySep Negative Selection- Mouse B Cell Isolation Kit (STEMCELL Technologies), which depletes for non-B cell markers and activated CD43+ B cells ...
-
bioRxiv - Systems Biology 2023Quote: ... Mouse splenic B cells were isolated using the EasySepTM Mouse B cell isolation Kit (STEMCELL technologies, 19854) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... B cells were isolated using an EasySep Human Pan-B Cell Enrichment kit (Stemcell Technologies, Vancouver, Canada).
-
bioRxiv - Immunology 2021Quote: ... B cells were enriched from PBMC by first using EasySep Human Pan-B cell Enrichment Kit (StemCell Technologies), and then stained with CD20-PB (2H7 ...
-
bioRxiv - Genomics 2020Quote: ... B cells were purified from a B6 mouse using an EasySep B cell negative selection kit (StemCell Technologies) and labelled with CFSE before being transferred at 4e6 per mouse ...
-
bioRxiv - Immunology 2021Quote: ... B cells were isolated from mouse spleens using EasySep mouse B cell isolation kit (Stemcell Technologies, Vancouver, Canada) according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... Naive B cells (CD19+CD27−IgD+) were enriched using Human naive B cell negative selection kit (Stemcell Technologies).
-
bioRxiv - Immunology 2023Quote: Splenic B cells or T cells were Isolated with EasySepTM Mouse B Cell Isolation Kit (#19854, StemCell Technologies) or EasySepTM Mouse T Cell Isolation Kit (#19851 ...
-
bioRxiv - Cancer Biology 2024Quote: ... spleen-derived B-cells were selected using the EasySep™ Mouse Pan-B Cell Isolation Kit (STEMCELL Tech).
-
bioRxiv - Cell Biology 2024Quote: B cells were isolated from mouse spleens using EasySep Mouse B Cell Isolation Kit (Stem Cell Technologies 19854) and attached to poly-D-lysine coated coverslips at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1X N2 supplement-B (STEMCELL Technologies). Day 3 media was NIM media supplemented with 2 µg/mL doxycycline ...
-
bioRxiv - Immunology 2020Quote: ... B cells were purified magnetically (STEMCELL Technologies) and stained with anti-CD19 ...
-
bioRxiv - Bioengineering 2023Quote: ... + STEMdiff Hematopoietic Supplement B (200x, StemCell Technologies). On day 5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1x N2 supplement B (StemCell Technologies, Inc.), 0.3% dextrose (D-(+)-glucose ...
-
bioRxiv - Microbiology 2019Quote: ... B cells were isolated from PBMCs through negative enrichment using EasySep Human B cell isolation kit (Stem Cell Technologies) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Naïve splenic B lymphocytes were purified by negative selection using the EasySep Mouse B Cell Isolation Kit (STEMCELL Technologies). Primary B cells from each transgenic mouse line were cultured in RPMI 1640 with L-glutamine supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2019Quote: ... B cells were enriched from the SCS using Mouse Pan-B Cell Isolation kits (Stemcell Technologies, Vancouver, BC, Canada). Briefly ...
-
bioRxiv - Immunology 2021Quote: Human B cells were enriched from cryopreserved PBMCs using the EasySep™ Human B Cell Enrichment Kit (STEMCELL Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Primary human B cells were isolated from PBMCs using the EasySep Human Naïve B cell isolation kit (Stemcell Technologies). Naïve B cells were cultured with or without VC (100 µg/mL ...
-
bioRxiv - Immunology 2022Quote: ... whereas the naïve B cells were isolated using the EasySep Human Naïve B cell isolation kit (Stem Cell Technologies). The purity of the B cells used in these experiments was > 95% ...
-
bioRxiv - Immunology 2023Quote: ... B cells were extracted by negative selection with the EasySep™ Human B Cell Isolation Kit (StemCell Technologies, #17954). EBV-containing supernatants from B95-8 cells were added to purified B cells supported by 30 µg mL-1 holo-transferrin and 2.5 µg mL-1 CpG (ODN2006) ...
-
bioRxiv - Immunology 2023Quote: B cells were isolated from naïve mouse spleens with EasySepTM Mouse Pan-B cell Isolation Kit (Stem Cell Technologies) and suspended in Opti-MEM™ I Reduced Serum Medium (Gibco) ...
-
bioRxiv - Immunology 2023Quote: B cells were isolated from naïve mouse spleens with EasySepTM Mouse Pan-B cell Isolation Kit (Stem Cell Technologies) and stimulated following the same method as BCR signal analyses described above ...
-
bioRxiv - Immunology 2023Quote: ... B cells were isolated from naïve mouse spleens with EasySepTM Mouse Pan-B cell Isolation Kit (Stem Cell Technologies) and suspended at 1 x 106 cells/mL in the supplemented RPMI1640 (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... B cells were isolated from the samples using RosetteSep Human B cell Enrichment Cocktail (Stemcell Technologies, Vancouver, BC, Canada) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Murine splenic B cells were isolated by negative selection using the EasySep Mouse B Cell Isolation Kit (STEMCELL Technologies, #19854A) as specified by the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mL N2 supplement B (StemCell Technologies, 07156)] supplemented with SB431542 (10 µM ...
-
bioRxiv - Immunology 2022Quote: ... All CD19+ B cells were isolated (STEMCELL Technologies EasySep Mouse B Cell Isolation kit ...