Labshake search
Citations for Primerdesign :
1 - 50 of 50 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: Detection of murine Col1a2 wild-type and mutant alleles was performed using a custom snpsig™ real-time PCR mutation detection/allelic discrimination kit (Primerdesign, Southampton, UK). 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign ...
-
bioRxiv - Molecular Biology 2019Quote: ... a Primer Design Real-Time PCR Internal Control Kit (PrimerDesign, Southampton, United Kingdom) was used ...
-
bioRxiv - Microbiology 2024Quote: Real time PCR (qPCR) was performed with the PrecisionPLUS qPCR Master Mix (Primerdesign, UK) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... Gene expression was determined based on real-time quantitative PCR using SYBR green (PP00259, Primerdesign). The data was analyzed with the ΔΔCT method and normalized to the housekeeping gene 36b4 ...
-
bioRxiv - Microbiology 2022Quote: ... swine fever or PRRSV was assessed by a multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) detection kit (Microplasma 16 s Ribosomal RNA Gene Genesig® Standard kit, [Primerdesign, Camberley ...
-
bioRxiv - Microbiology 2019Quote: ... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were initially examined for SARS-CoV-2 RNA by COVID-19 Genesig® Real-Time PCR assay (Primerdesign Ltd., Chander’s Ford, UK) after RNA extraction with the Magna Pure Compact system (Roche Molecular Systems Inc. ...
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on Bio-Rad CFX96 Touch using SYBR-green-based PrecisionFAST with LOW ROX qPCR kit (Primerdesign). The reading was normalized by that of β-tubulin transcript (TUBB) ...
-
bioRxiv - Microbiology 2019Quote: ... and using DENV RT primer/probe Mix kit (Genesig, Primerdesign Ltd., UK) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Transcript levels were measured by reverse transcription quantitative PCR (RT-qPCR) using Sybr Green master mix (Primerdesign Ltd.) and a StepOnePlusTM Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... or Precision Reverse Transcription Premix (PrimerDesign, cat. no: RT-premix2). Primers for sequencing cDNA for testing Espn splicing in Espnspdz mice were designed using Primer375 (Supplementary Table 3) ...
-
bioRxiv - Systems Biology 2020Quote: ... or Precision Reverse Transcription Premix (PrimerDesign, cat. no: RT-premix2). MicroRNA cDNA was made using the miRCURY LNA RT Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was reverse transcribed (RT) by Precision Nanoscript2 (PrimerDesign, UK), following manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... RT-qPCR reactions for tissue samples were prepared using Precision SYBRgreen Mastermix (Primerdesign, UK), 175 nM forward and reverse primers (Eurofins ...
-
bioRxiv - Immunology 2021Quote: ... to measure HRV-16 replication in AEC cultures we used the Genesig® Human Rhinovirus Subtype 16 PCR Kit (Primerdesign®).
-
bioRxiv - Genomics 2020Quote: ... RT-qPCR reactions were performed using PrecisionPLUS-MX-SY Mastermix (containing SYBR Green; Primerdesign Ltd) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Immunology 2021Quote: ... To measure SARS-CoV-2 replication in AEC cultures we used the Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit (Primerdesign®), with duplicate assays of harvested RNA from each SARS-CoV-2-infected AEC experimental condition ...
-
bioRxiv - Biochemistry 2021Quote: ... with triplicate assays of harvested RNA from each SARS-CoV-2-infected AEC donor cell line (Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit, Primerdesign®, Southampton, UK). The concentration of RNA harvested from AECs was used to normalize the qPCR data and was measured on a spectrophotometer (Nanodrop®).
-
bioRxiv - Cancer Biology 2021Quote: ... 20 ng RNA was used as template for quantitative PCR with Precision OneStep qRT-PCR master mix (PrimerDesign, Southampton, UK). Quantitative PCR was performed with a StepOnePlus Real-Time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Twenty-five nanograms of total RNA was used per reaction with PrecisionPLUS OneStep RT-qPCR Master Mix (PrimerDesign, UK) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µl qRT-PCR reactions were performed using Precision PLUS qPCR Master Mix with SYBR green (PrimerDesign) in 384-well white plates on a Roche LightCycler 480 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The reaction was set up as follows: 1x of PrecisionFastTM qRT- PCR Master Mix with Low ROX (Primerdesign Ltd., UK), 200 nM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... Genesig® Plasmodium species kits (Primerdesign™ Ltd, UK) according to manufacturers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Genesig Easy DNA/RNA Extraction Kit (Primerdesign, Southampton, UK) and stored until further use.
-
bioRxiv - Molecular Biology 2020Quote: ... All cDNA was prepared using the RTnanoscript2 kit (Primerdesign), using 1600ng of RNA per reaction ...
-
bioRxiv - Microbiology 2021Quote: ... Genesig Easy DNA/RNA Extraction Kit (Primerdesign, Southampton, UK). PCR reactions consisted of each primer at 10 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign) in Bio-Rad CFX96 Touch™ real-time PCR detection system ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... according to the instructions provided by nanoScript2 Reverse Transcription Kit (Primerdesign Ltd). cDNA was stored at -20°C until its use in qPCR [46].
-
bioRxiv - Genetics 2019Quote: ... NADH and 16S (selected using the geNorm kit from PrimerDesign Ltd UK). Prevalidated primers (PrimerDesign Ltd UK ...
-
bioRxiv - Neuroscience 2020Quote: ... and RNA was reverse transcribed by Nanoscript reverse transcription kit (Primerdesign, UK) with the final working cDNA concentration of 1ng/μL ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was performed using Precision NanoScript 2 Reverse-Transcription-kit (PrimerDesign) and qPCR using PrecisionPLUS 2x qPCR MasterMix with ROX and SybrGreen (PrimerDesign) ...
-
bioRxiv - Molecular Biology 2020Quote: ... B2M and PAK1IP1 were taken from the geNorm and geNorm PLUS kits (Primerdesign): all give efficiencies of 95-105% and produce single amplicons ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed to cDNA using a Precision Reverse Transcription kit (PrimerDesign, Southampton, UK) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed to cDNA using a Precision Reverse Transcription kit (PrimerDesign, Southampton, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription primed by random nonamer primers was conducted using nanoScript 2 Reverse Transcription kit (Primerdesign). The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted nucleic acids were tested using the commercial kit Path-ISKNV-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Pathology 2020Quote: ... bacterial DNA was extracted using Genesig® Easy DNA/RNA Extraction Kit (Primerdesign Ltd, Southampton UK) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The subsequent reverse transcription was conducted using nanoScript 2 Reverse Transcription kit and random nanomer primers (Primerdesign). The real time PCR was performed on Bio-Rad CFX96 Touch using SYBR-green-based PrecisionFAST with LOW ROX qPCR kit (Primerdesign) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was then converted to complementary DNA (cDNA) using the Precision™ Reverse-Transcription Premix 2 kit (PrimerDesign LTD) per manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Their genomic DNA (gDNA) residuals were removed from samples with DNase I from PrecisionDNAse kit (Primerdesign, Blirt DNA, Gdansk, Poland). Purified RNA (500 ng ...
-
bioRxiv - Microbiology 2020Quote: ... For this the homogenised tissues were subjected to total nucleic acids extraction (~20mg of each organ) using the Genesig Easy DNA/RNA Extraction Kit (Primerdesign) as described earlier ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with equal amounts of oligo(dT) and random nonamer primers using the nanoScript2 reverse transcription kit (Primerdesign Ltd., Southampton, UK). Transcript levels were measured by reverse transcription quantitative PCR (RT-qPCR ...