Labshake search
Citations for Macherey-Nagel GmbH :
1 - 50 of 366 citations for Peripheral Blood Mononuclear Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... RNA was isolated from peripheral blood mononuclear cells (PBMC; NucleoSpin RNA Mini Plus, Macherey-Nagel GmbH & Co.KG, Düren, Germany). For cDNA first strand synthesis RevertAid kit (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA was isolated from the peripheral blood and tail tissues of each chimeric mouse 30 days after BM transfer using a NucleoSpin tissue kit (Macherey-Nagel, Duren, Germany). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was isolated from peripheral blood and tail tissues of each chimeric mouse 6 weeks after BM transplantation with NucleoSpin® Tissue Kit (MACHEREY-NAGEL, Duren, Germany). Then ...
-
bioRxiv - Immunology 2019Quote: Genomic DNA was isolated from sorted cells using NucleoSpin Blood kits (Macherey-Nagel). PCR was used to amplify gRNA cassettes with Illumina sequencing adapters and indexes as described previously43 ...
-
bioRxiv - Systems Biology 2020Quote: RNA from blood was extracted using NucleoSpin RNA Blood Mini kit (Macherey-Nagel). Lysis buffer and proteinase K were added to the frozen pellet and shaken while thawing ...
-
bioRxiv - Genomics 2021Quote: ... and from blood using the NucleoSpin Blood QuickPure Kit (from the company Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... with NucleoSpin Blood (Macherey-Nagel) and PCR amplification ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was isolated from cell pellets using the NucleoSpin Blood XL Kit (Macherey-Nagel). The sgRNA sequence was amplified by PCR with sufficient gDNA to maintain representation ...
-
bioRxiv - Microbiology 2023Quote: Whole blood DNA was extracted using the NucleoSpin 96 Blood core kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... Genomic DNA from the cell pellets was purified using the NucleoSpin blood L kits (Macherey-Nagel) according to the manufacturer’s instructions and was quantified using PicoGreen dsDNA assay kits (ThermoFisher).
-
bioRxiv - Genomics 2023Quote: NucleoSpin Blood kit (Macherey-Nagel, 740951.50) was used to isolate the genomic DNA ...
-
bioRxiv - Physiology 2020Quote: ... Genomic DNA from 32 MPM cell lines was extracted with Nucleospin Blood kit (Macherey-Nagel, Düren, Germany) and 500 ng were hybridized to Affymetrix CytoScanHD Arrays (Affymetrix ...
-
bioRxiv - Immunology 2024Quote: ... gDNA from T cells and frozen liver biopsies was extracted with NucleoSpin® Blood kit (Macherey-Nagel) and TCRβ sequencing was performed as previously described45.
-
bioRxiv - Genetics 2020Quote: DNA was extracted from blood samples using the NucleoSpin Blood kit (Macherey-Nagel, GmbH & Co. KG, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... or NucleoSpin Blood Kit (Macherey-Nagel, Germany). SV breakpoints were confirmed with Sanger Sequencing where possible ...
-
bioRxiv - Genomics 2023Quote: High molecular weight DNA was extracted from blood cells using a NucleoBond AXG column (Macherey-Nagel, Düren, Germany), which was followed by purification with phenol-chloroform ...
-
bioRxiv - Microbiology 2023Quote: ... and the selection of inactivated cells was performed by DNA extraction using the NucleoSpin Blood kit (Macherey-Nagel) followed by PCR amplification using primers flanking the Cas9 cleavage site ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was extracted from 400 µL whole blood using the NucleoSpin RNA Blood Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was extracted from ethylenediaminetetraacetic acid (EDTA)-anticoagulated blood using NucleoSpin Blood Quick Pure kit (Macherey-Nagel, Duren, Germany) and was stored in the gene bank run by Azabu University (Kanagawa ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.2–0.4 mL) of mouse whole blood was isolated using NucleoSpin RNA Blood (Macherey-Nagel GmbH & Co.) according to the manufacturer’s instructions with on-column DNA digestion ...
-
bioRxiv - Neuroscience 2019Quote: ... Genomic DNA was isolated from blood samples of all participants using NucleoSpin® Blood L (Macherey-Nagel GmbH & Co. KG) for whole exome sequencing (WES) ...
-
bioRxiv - Genomics 2023Quote: Total RNAs were extracted from blood of 137 ewes with the Nucleospin® RNA Blood Kit (Macherey-Nagel, #Ref 740200.50) according to the manufacturer’s protocol starting with 800µL of whole blood with a DNAseI digestion treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... NucleoSpin Blood L kit (#740569.10) was from Macherey-Nagel. ECL Western Blotting Detection Reagent (#RPN2106 ...
-
bioRxiv - Cell Biology 2019Quote: ... using the NucleoSpin Blood L kit (Macherey-Nagel, #740569.10) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the NucleoSpin Blood Kit (Macherey-Nagel; Dueren, DE) following the manufacturer’s protocol and used as template in diagnostic PCR ...
-
bioRxiv - Microbiology 2023Quote: Whole peripheral blood was collected from newly hatched chicks and total DNA was extracted using the NucleoSpin 96 Blood core kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was successfully isolated from blood cells of 34 14-day-old great tits with NucleoSpin RNA Plus Kit (Macherey-Nagel). Packed blood cells (10 µl per sample ...
-
bioRxiv - Immunology 2020Quote: ... gDNA were extracted with NucleoSpin® Blood kit (Macherey-Nagel) and TCR sequencing was performed by Adaptive BiotechnologiesR (Seattle ...
-
bioRxiv - Genetics 2024Quote: ... DNAs were extracted using NucleoSpin Blood XL (Macherey-Nagel#740950). Samples were prepared for sequencing as previously described35.
-
bioRxiv - Genetics 2023Quote: 200K cells were collected on day 14 after crRNA transduction and genomic DNA was isolated using NucleoSpin Blood (Macherey-Nagel, Catalog no. 740951.50). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using a NucleoSpin Blood kit (Macherey-Nagel) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... gDNA was isolated using the NucleoSpin Blood Mini Kit (Macherey-Nagel). The gDNA concentrations were quantitated by Qubit.
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... Total DNA was extracted using NucleoSpin blood mini kit (MACHEREY-NAGEL). sgRNA was amplified by PCR using mixed P5 primer and P7 primer with i7 index sequence ...
-
bioRxiv - Microbiology 2020Quote: ... falciparum genomic DNA was isolated using NucleoSpin® Blood Columns (Macherey-Nagel) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA (gDNA) was extracted using the NucleoSpin Blood kit (Macherey-Nagel). The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoMag Blood 200 μL kit (Macherey-Nagel).
-
bioRxiv - Immunology 2023Quote: ... genomic DNA was extracted using NucleoSpin Blood L kit (Macherey-Nagel, Germany) according to manufactureŕs instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... or Macherey-Nagel Nucleospin Blood L kit (Macherey-Nagel; Cat. No. 740954.20), depending on the number of cells recovered from FACS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted using Nucleospin Blood XL kit (Macherey-Nagel cat# 740950) and eluted into 1ml elution buffer ...
-
bioRxiv - Developmental Biology 2022Quote: Genomic DNA was isolated with Macherey-Nagel− NucleoSpin− Blood kit (740951.50, Macherey-Nagel) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the Nucleo-Mag Blood 200 µl DNA Kit (Macherey-Nagel, Düren, Germany) was used for extraction and clean-up of genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted using Nucleo Spin RNA Blood (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was extracted using the NucleoSpin® Blood Mini kit (Macherey-Nagel). The targeted loci were amplified with primers (oJAH262 and oJAH263 for HEK3_3a target site ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA (gDNA) was isolated using the XL Maxi NucleoSpin Blood kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... falciparum positive DBS was extracted with the NucleoMag Blood 200 μL kit (Macherey-Nagel) using an optimized protocol for DNA extraction from whole 50 μL DBS ...