Labshake search
Citations for Applied Biological Materials :
1 - 50 of 143 citations for ssc mir 323 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2022Quote: ... and confirmed mycoplasma free using a PCR detection kit (ABM G238). Recombination of the LSL-Nras allele was verified by PCR using the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was performed using the EvaGreen qPCR Mastermix (Applied Biological Materials, BC, Canada), and the results were normalized to the signals of GAPDH expression ...
-
bioRxiv - Cell Biology 2022Quote: ... Mycoplasma testing was conducted monthly using a mycoplasma PCR detection kit (ABM, G238). Human and mouse cell lines were authenticated by STR profiling (Almeida et al. ...
-
bioRxiv - Genomics 2022Quote: ... The cells were tested for Mycoplasma contamination with the PCR detection kit (ABM) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were regularly checked for mycoplasma contamination utilizing a PCR detection kit (G238, ABM) or Hoechst staining ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were tested for mycoplasma using PCR-based screening (PCR Mycoplasma Detection Kit, Cat# G238, Applied Biological Materials Inc.) weekly or biweekly.
-
bioRxiv - Cancer Biology 2020Quote: ... and the absence of mycoplasma was confirmed using Mycoplasma PCR detection kit (Applied Biological Materials).
-
bioRxiv - Microbiology 2024Quote: ... Cells were monitored routinely for mycoplasma contamination using a mycoplasma detection PCR kit (ABM, G238). A FLAG (NiV-F-FLAG ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested for mycoplasma contamination (PCR Mycoplasma Detection Kit, Applied Biological Materials, G238) and were found to be negative ...
-
bioRxiv - Microbiology 2021Quote: ... free by testing using the ABM Mycoplasma PCR Detection Kit (G238, Applied Biological Materials Inc., Canada).
-
bioRxiv - Microbiology 2022Quote: ... Cells were routinely confirmed to be mycoplasma negative according to PCR Mycoplasma Detection Kit (ABM Inc.) and were used at low passage (<10 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were screened for mycoplasma contamination using the Mycoplasma PCR Detection Kit (Applied Biological Materials, Inc.).
-
bioRxiv - Microbiology 2022Quote: ... 2μl of pre-amplified cDNA or NRT control reaction was used as template for multiplexed real-time PCR reactions using TaqProbe 5x qPCR MasterMix-Multiplex (ABM MasterMix-5PM), 5% DMSO ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were periodically evaluated for mycoplasma contamination by a mycoplasma PCR detection kit (Cat# G238, ABM). Cells were genotyped at the beginning and end of the study.
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma contamination was regularly assessed using the polymerase chain reaction (PCR) mycoplasma detection kit (G238, ABM).
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were periodically evaluated for mycoplasma contamination by a mycoplasma PCR detection kit (Cat# G238, ABM). Authenticity of cell lines was evaluated by detection of ten genetic loci using the GenePrint® 10 System (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination (Mycoplasma PCR Detection Kit, Applied Biological Materials).
-
bioRxiv - Systems Biology 2022Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination (Mycoplasma PCR Detection Kit, Applied Biological Materials).
-
bioRxiv - Immunology 2020Quote: ... Cells were confirmed to be Mycoplasma-free using a PCR Mycoplasma Detection Kit (Applied Biological Materials Inc. G238). Cells were cultured in a 37°C humidified incubator containing 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... hES cells were routinely tested for Mycoplasma using the Mycoplasma PCR Detection kit (Applied Biological Materials, Richmond, Canada).
-
bioRxiv - Biochemistry 2021Quote: ... Cells used in this work were confirmed mycoplasma-free using the Mycoplasma PCR Detection Kit (Applied Biological Materials G238) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were confirmed free of mycoplasma and monitored at regular intervals using a Mycoplasma PCR Detection Kit (ABM G238).
-
bioRxiv - Cell Biology 2020Quote: ... HeLa and RPE1 cells were tested and found negative for mycoplasma using a PCR mycoplasma detection kit (ABM, Bellingham, WA). Cell types were authenticated by sequencing 24 loci (University of Utah Sequencing Core).
-
bioRxiv - Cancer Biology 2022Quote: ... The cell line identities were confirmed by genotyping using short tandem repeat fingerprinting and were tested negative for mycoplasma with Mycoplasma PCR Detection Kit (ABM).
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used were regularly tested for mycoplasma contamination using a PCR Mycoplasma Detection Kit (Applied Biological Materials, G238).
-
bioRxiv - Genetics 2020Quote: ... Primary cell cultures were tested monthly for mycoplasma using a PCR Mycoplasma Detection Kit (Applied Biological Materials, Richmond, BC, Canada).
-
bioRxiv - Cell Biology 2021Quote: ... The absence of Mycoplasma contamination was verified for all cell lines using a sensitive PCR based detection kit (ABM: G238).
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma infection using a PCR mycoplasma detection kit according to the manufacturer’s instructions (ABM Inc.).
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cancer Biology 2021Quote: Real-time PCR was performed for miR-21-5p in A2780R cells infected with lentivirus from Zip control (pLenti-III-miR-GFP control vector from Applied Biological Materials #m001) or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector ...
-
bioRxiv - Cancer Biology 2023Quote: U-87 MG and U-251 MG GBM cell lines were obtained from ATCC and tested to be mycoplasma free using the Mycoplasma PCR Detection Kit (Applied Biological Materials Inc; G238), prior to experimentation ...
-
bioRxiv - Neuroscience 2023Quote: ... confirmed normal copy number at various mutation hotspots and assessment with a Mycoplasma PCR Detection Kit (Cat# G238, Applied Biological Materials Inc., Richmond, BC, CAN) indicated that cell stocks are free of mycoplasma.
-
bioRxiv - Cell Biology 2020Quote: ... and pLenti-III-miR-GFP Control Vector (Cat: M001, Applied Biological Materials) were purified using the EndoFree Plasmid Maxi Prep Kit (Cat ...
-
bioRxiv - Immunology 2022Quote: ... One quarter of the total RNA sample was used as template for OneStep RT-PCR (ABM) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed to generate cDNA using 5X All-In-One RT MasterMix (with AccuRT Ge5X All-In-One RT MasterMix and AccuRT Genomic DNA Removal Kit) (Applied Biological Materials) for RT–qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... hsa-miR-203a miRNA mimic (MIMAT0000264) and antagomir (MIMAT0031890) were obtained from ABM.
-
bioRxiv - Cell Biology 2020Quote: ... the LentimiRa-GFP-hsa-miR-494-3p Vector (Cat: mh10739, Applied Biological Materials, abmgood.com) and pLenti-III-miR-GFP Control Vector (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector, Applied Biological Materials #mh10276). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...