Labshake search
Citations for Bio-Rad :
1 - 50 of 2443 citations for Solute Carrier Family 41 Member 2 SLC41A2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The QX 200 carrier oil (Bio-rad) used as continuous phase in the droplet generation was loaded into a 20 ml syringe (BD) ...
-
bioRxiv - Immunology 2022Quote: ... The members were visualized on X-ray films or ChemiDoc Imaging System (BioRad, Hercules, CA) following the reaction with the enhanced chemiluminescence substrate (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
bioRxiv - Biochemistry 2021Quote: ... Drl family ECRs were further purified using an UnoQ anion exchange column (Bio-Rad), loading in 20 mM HEPES pH 7.5 containing 70 mM NaCl and using an elution gradient of 70 mM-1 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... bead suspension and carrier oil (QX200 droplet generation oil, Bio-Rad) were first loaded in syringes and then placed in syringe pumps (Leafluid) ...
-
bioRxiv - Plant Biology 2021Quote: ... and load 15 48 µl mixture onto the center of carrier (Bio-RAD), air dry ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... as previously described.41 We used a Bradford assay (Bio-Rad Laboratories, Hercules, CA, USA) to measure protein content ...
-
bioRxiv - Microbiology 2024Quote: ... Each master mix solution contained: 5ul SSO Advanced Universal SYBR Supermix 41 (Biorad, Hercules, CA, USA), 0.3ul of primers (10uM ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μl DNA-coated gold microcarriers were dropped onto a microparticles carrier disk (Macrocarriers #1652335, Bio-Rad) and bombardment was carried out using a PDS-1000/He Biolistic Particle Delivery System (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and macro carrier discs (Inbio Gold) were used in a PDS1000/He Biolistic Particle Delivery System (Biorad). Transgenic strains were maintained on NGM agar supplemented with 0.3mg/mL Hygromycin B (Formedium) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the solutions were co-encapsulated in monodisperse droplets of 125 µm in an inert carrier oil (BioRad Evagreen) using microfluidic device fabricated in-house ...
-
bioRxiv - Neuroscience 2022Quote: ... At 8DIV cultures were shot with 1.6 micron Gold micro-carriers coated with 30 μg of hSyn.iGABASnFR.F102G plasmid using the Helios gene-gun system (Bio-Rad). Following transfection cultures remained for 5-10 days before experiments were carried out.
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was precipitated onto 10-micron gold carriers for biolistic bombardment of the macronucleus using a Gene Gun (Bio-Rad). For disruption of Q22YU3/SHULIN (TTHERM_00122270 ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Microbiology 2022Quote: ... and trap (primers 41 + 42) transcript levels by RT-qPCR was performed using iQ or iTaq™ Universal SYBR Green supermix (Bio-Rad) and the iQ5 or CFX96 real-time PCR detection systems (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biophysics 2023Quote: ... The motility surface was coated with 0.8% anti-tubulin antibody (BioRad YL1/2) in BRB-80 buffer for 5 minutes ...
-
Paralog editing tunes rice stomatal density to maintain photosynthesis and improve drought tolerancebioRxiv - Plant Biology 2022Quote: ... coated with 5 mg of plasmid DNA for editing rice STOMAGEN were divided equally among 10 macro-carriers and used for bombardment with a Bio-Rad PDS-1000 He biolistic device (Bio-Rad, Hercules, CA, USA) at 650 psi ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ... incubated with goat α-rabbit 2° antibody conjugated to HRP (1:5000) (Bio-Rad) in TBS-T at room temperature (1 h) ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Neuroscience 2020Quote: ... TBS-T) before incubation with HRP-conjugated secondary antibody for 2 hours (Biorad, 1:1000). After 3 times washes with 5 min intervals with TBS-T ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti–α-tubulin (MCA77G YL1/2, rat monoclonal; Bio-Rad), anti-GAPDH (mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... and probed with each primary antibody diluted in 2% blotting-grade non-fat dry milk (BioRad). Next ...
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...
-
bioRxiv - Microbiology 2021Quote: ... fixed with methanol supplemented with 2% H2O2 and incubated with a biotinylated anti-RSV antibody (Bio-Rad) in PBS containing 1% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody staining was done in 2% milk-TBST (+ 0.01% sodium azide) and detected using ChemiDoc (Biorad).
-
bioRxiv - Neuroscience 2023Quote: ... or anti-rat TCRαβ antibody (2 µg/rat dissolved in saline solution, clone R73, Bio-Rad #MCA453GA) from day 9 to day 14 to deplete DRG T cells as previously described 66 ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Biophysics 2023Quote: ... slides were prepared with unlabeled microtubules attached to the slide surface via an anti-tubulin antibody (BioRad YL1/2). Kinesin-liposome complexes were added to the flow cell and imaged in TIRF ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Pathology 2022Quote: ... The CD68 primary antibody incubation was performed at room temperature for 2 hours (mouse CD68, BIO-RAD, MCA1957, 1:750) and CD11b staining (BD Pharmigen ...
-
bioRxiv - Biochemistry 2021Quote: ... blots were incubated for 1-2 h at RT with an anti-rabbit HRP-conjugated secondary antibody (diluted 1 : 3,000, Bio-Rad) in TBST with 5% milk ...
-
bioRxiv - Microbiology 2021Quote: ... The nitrocellulose strips were blocked in PBS with casein for 30 mins at room temperature and then probed for 1 hour with monoclonal antibodies (mAb) recognizing H3 HA (clone 36/2 (26)) or IAV M1 matrix protein (clone MCA401, BioRad). Strips were washed and incubated for 1 hour with a horse radish peroxidase (HRP)-conjugated secondary immunoglobulin (DAKO) ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were incubated with an anti-F4/80 antibody (CI:A3-1; Bio-Rad, Feldkirchen, Germany). After incubation with biotinylated goat anti-rat IgG (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... Blocked membranes were incubated with HuCAL anti-bovine Mincle CRD antibodies (2.5 µg mL-1) before incubation with secondary goat-anti-human IgG F(ab’)2: HRP (STAR126P, Bio-Rad) antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membranes were then incubated with HRP-coupled secondary antibodies (1:10,000, CST) for 2 h at 25°C and visualized by ChemiDoc XRS (Bio-Rad) instrument.
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated with 1:200 rabbit-anti NF-B p65 polyclonal antibody (Pierce) (2 h) and 1:5000 Goat anti-rabbit IgG (H+L)-HRP conjugate (Bio-Rad) (1 h) ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 2 h at room temperature and a HRP-conjugated goat anti-rabbit secondary antibody (Bio-Rad 1706515; 1:3000 dilution) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-SARS CoV-2 Spike Neutralizing antibody (SAD-S35, ACRO, USA) or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were incubated with appropriate primary and secondary antibodies listed in Table 2 in 5% milk and developed using the Clarity Western enhanced chemiluminescence substrate system (1705060, Bio-Rad) in a Xograph Compact X5 processor ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation for 2 hours at room temperature with HRP-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies (Bio-Rad), diluted 1:5000 in 5% nonfat milk in TBS-T ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 50 µL/well of 2 µg/mL of mouse anti-bovine IFN-γ mAb (CC330 Bio-Rad Antibodies) diluted in carbonate coating buffer (pH 9.6 ...
-
bioRxiv - Cell Biology 2023Quote: ... before being re-incubated with the secondary antibodies at room temperatures for 2 h and then subjected to the imaging of immunoblots by Bio-Rad instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by washes at room temperature (1 x 15 min, 2 x 5 min) and incubation with HRP-conjugated secondary antibodies (Bio-Rad) for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatants were incubated with either 2 µg of anti-PAR antibody (clone #19, custom designed at AbD Serotec, Bio-Rad) or Human IgG F(ab)2 (Rockland ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...