Labshake search
Citations for Bio-Rad :
1 - 50 of 6989 citations for QuantiFluo Caspase 3 Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: FLICA assays were conducted using FAM FLICA poly caspase kit (BioRad) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... caspase-9 and caspase-3 was done using a CFX-96 real-time PCR system (BioRad, Hercules, CA, USA). The reaction mixture for each sample carried 2 µL of cDNA ...
-
bioRxiv - Immunology 2020Quote: Densitometric analysis of cleaved caspase 3 immunoblots from three independent experiments were performed using the VersaDoc Imaging System (Bio-Rad) and analyzed with ImageJ 1.52p Fiji package software (https://imagej.net/Fiji) ...
-
bioRxiv - Microbiology 2023Quote: ... FLICA 660 Caspase-1 (Bio-Rad) substrate was then resuspended in DMSO following the manufacturer’s protocol and applied 1:30 on the cells ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Evolutionary Biology 2019Quote: A commercial colorimetric protein assay kit (DCTM Protein Assay Kit, Bio-Rad, Hercules, USA) was used to quantify total protein content of the coral host tissue ...
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein assay was performed using DC Protein Assay kit (BioRad). One mg of total protein of each sample were immunoprecipitated with 50 ul of p53 antibody (D0-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein assays were performed using DC Protein Assay kit (BioRad) and was used to load equivalent total protein on 4-15% gradient (SDS)-polyacrylamide gel (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations were determined by the Bradford method using a Bio-Rad protein assay kit or Lowry’s assay with a DC protein assay kit (Bio-Rad Laboratories). TonB2 was detected using the ECL Western Blotting Detection System (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined by the Bradford method using a Bio-Rad protein assay kit or Lowry’s assay with a DC protein assay kit (Bio-Rad Laboratories). TonB1 and DdvT were detected using the ECL Western Blotting Detection System (GE Healthcare ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Plant Biology 2022Quote: ... Bradford protein assay kit (Bio-rad) was used to determine protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... A DC protein assay kit (BioRad) was used to determine the protein concentration of individual samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined with Bradford assay (Bio-Rad protein assay kit). An equal amount of proteins was denatured in SDS–PAGE sample buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The BCA Assay kit (Bio-Rad, USA) was used to test protein concentration ...
-
bioRxiv - Biochemistry 2020Quote: ... An aliquot of the final supernatants was saved for determination for total protein by Bio-Rad Protein Assay Kit (#5000002, Bio-Rad, USA) with bovine serum albumin as the standard at 595 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... the supernatant obtained was used for protein concentration estimation by Bio-Rad DC protein assay kit (Bio-Rad, CA). Approximately 30-40 μg of protein was loaded into each well of an SDS-PAGE gel ...
-
bioRxiv - Systems Biology 2021Quote: ... Bradford protein assay kit (Bio-Rad®) with standard Bovine Serum Albumin (BSA ...
-
bioRxiv - Biochemistry 2022Quote: ... DC Assay kit was from Bio-Rad. Phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The DC protein assay kit II (BioRad) was used to quantify protein concentrations ...
-
bioRxiv - Cancer Biology 2024Quote: ... The protein concentration of the cell and tissue lysate was determined by Bio-Rad protein assay kit (Bio-Rad, Hercules, CA). 35 µg of whole-cell lysate or whole-tissue lysate was separated on NuPAGE Novex 4-12% Bis-Tris Gels and transferred on iBlot transfer stack using iBlot dry blotting transfer system (Life Technologies) ...
-
bioRxiv - Immunology 2019Quote: ... Cells were then stained for inflammasome activation using a caspase-1 FAM-YVAD-FMK FLICA probe kit (Bio-Rad). Cells were then processed for analysis by flow cytometry.
-
bioRxiv - Pathology 2020Quote: ... Protein concentration was determined with the Bradford assay (Bio-Rad protein assay kit). An equal amount of proteins was denatured in SDS–PAGE sample buffer ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentration was assessed by the Bradford Assay (Biorad Protein Assay Kit II) and 25ug of cell lysates from each condition were resolved by 8% SDS-PAGE with NuPAGE electrophoresis system (Invitrogen/Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... A modified Lowry assay kit (DC Protein Assay) was purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined by a colorimetric assay (DC protein assay kit, BioRad). All samples were diluted to a protein concentration of 1.2 mg/ml in a total volume of 75 µl of RIPA and shipped to Eve Technologies (Calgary ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein concentrations were determined via Bradford assay (Bio-Rad Protein Assay Kit II; (75)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the Experion RNA StdSens Assay Kit (BioRad), respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... The DC protein assay kit (Bio-Rad Laboratories) was used to test the protein content ...
-
bioRxiv - Microbiology 2021Quote: ... Protein estimation was performed by Bio-rad DC protein assay kit (Bio-Rad Laboratories, USA). The supernatant proteins were used for in-solution digestion and TMT-pro labeled proteomics as described by us previously [7].
-
bioRxiv - Immunology 2022Quote: ... The washed immunoprecipitates were boiled in SDS sample buffer and the protein content was determined by Bio-Rad protein assay kit (#5000002, Bio-Rad, Hercules, CA). Equal amounts (30-50 µg ...
-
bioRxiv - Microbiology 2022Quote: ... DC Protein Assay kit (Bio-Rad, Hercules, CA) was used to quantify protein concentration in each sample ...
-
bioRxiv - Microbiology 2023Quote: DC Protein Assay kit was purchased from BioRad. SuperSignal West Pico Chemiluminescent Substrate was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Detergent-compatible (DC) protein assay kit (Bio-Rad) was used to determine protein content.
-
bioRxiv - Cancer Biology 2024Quote: ... the protein quantification assay kit from Bio-Rad, PVDF membrane was brought from Millipore-USA ...
-
bioRxiv - Genetics 2024Quote: ... using the DC Protein Assay Kit II (BioRad). Luciferase activities were measured on a GloMax Luminometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The concentration of GFPnb was determined by Bradford assay (Bio-Rad Protein Assay Kit II) and was diluted with equilibration buffer and glycerol to a final concentration of 20 mg/mL protein (160 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein concentrations were determined via Bradford assay (Bio-Rad Protein Assay Kit II; Bradford 1976), diluted with crystal buffer (5 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein content was measured using the Lowry protein assay kit (DC Protein Assay; Bio-Rad). Homogenates were sonicated and centrifuged for 15 min at 5000 g ...
-
bioRxiv - Pathology 2022Quote: ... using Bio-Rad Protein Assay Kit II (Bio-Rad), or DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples were quantified using DC protein assay kit (BioRad) and equal concentration samples were then prepared for SDS-PAGE in loading buffer (40% Glycerol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were quantified by DC Protein Assay Kit (BioRad). Gel electrophoresis was run in Criterion TGX Stain-Free Gels (BioRad) ...