Labshake search
Citations for Bio-Rad :
1 - 50 of 1951 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Genetics 2019Quote: ... α-tubulin is monoclonal antibody of rat that can recognize alpha subunit (AbD Serotec/BioRad, MCA77G). The second antibodies for staining were Alexa-fluor 488 (Goat ...
-
bioRxiv - Immunology 2023Quote: ... Proteasome activity assays were performed using the ProteasomeGlo assay following the manufacturer’s instructions (BioRad). To model endothelial cell ROS production ...
-
bioRxiv - Biochemistry 2019Quote: ... Ribosomal subunits were characterized by SDS-PAGE (BioRad Any kD precast gels), the Pierce Silver Stain Kit (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... Transcriptionally active Q0.3 fraction (0.32–0.4 M) were pooled and applied directly to hydroxyapatite (HAP) type II ceramic resin (Bio-Rad), washed first at 0.38 M ...
-
bioRxiv - Neuroscience 2022Quote: ... and beta mercaptoethanol (0.05 M, BioRad Laboratories Cat#1610710) and loaded into a NuPAGE 4%–12% or 10% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 10% beta-mercaptoethanol (BME) (Bio-Rad 161-0710) was added to 15µg of total protein.
-
bioRxiv - Microbiology 2023Quote: ... and 0.25ul of beta-mercaptoethanol (Bio-Rad #161-0710) and boiling the reaction at 100C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... A SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples ...
-
bioRxiv - Microbiology 2021Quote: ... an assay detecting the human ribonuclease P/MRP subunit p30 RPP30 gene (Bio-Rad Assay ID dHsaCP2500350) was used as reference (probe ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... and Foresight CHT Type II (Bio-Rad) columns with sodium phosphate gradient ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... with beta-mercaptoethanol and run using a Mini-PROTEAN Electrophoresis and Transfer system (BioRad). Membranes were incubated with primary antibody overnight at 4°C (ME1 ...
-
bioRxiv - Physiology 2023Quote: ... We normalized the protein bands to beta-tubulin with Image Lab software (Bio-Rad). For citrate synthase activity ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed by Western blot as previously described.21 Densitometry was performed to quantify the cleavage efficiency of full-length spike to S1/S2 subunits using ImageLab 6.0.1 (Bio-Rad #12012931). The average results of two experiments were presented.
-
Transient upregulation of translational efficiency in prodromal Tg2576 mice precipitates AD symptomsbioRxiv - Neuroscience 2019Quote: ... the two subunits 60S and 40S as well as the very light mRNPs were detected by UV absorbance at 256 nm (BioRad) and each gradient was collected in 10 fractions ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Cancer Biology 2023Quote: ... wild-type EGFR probe (Assay ID: dHsaCP2000020, BioRad), HaeIII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: TGF-beta isoforms were measured with the Bio-Plex Pro TGF-β assays (Bio-Rad) in accordance with manufactures directions ...
-
bioRxiv - Neuroscience 2022Quote: ... input and precipitated samples were prepared in 5x SDS buffer containing beta-mercaptoethanol (Bio-Rad) and boiled for 5 minutes at 90° C ...
-
bioRxiv - Cell Biology 2022Quote: ... The stoichiometry of condensin II subunits for each preparation was checked by 5% SDS-PAGE followed by Coomassie Brilliant Blue R-250 (Bio-Rad) staining ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µg of capture antibody for each cytokine/chemokine type was coupled to 1.25×107 Bio-Plex Pro™ Magnetic COOH Beads (BioRad, Catalog# MC10053-01) using Bio-Plex Amine Coupling Kit (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2019Quote: ASM and AIM proteins were dissolved in 2X Laemmli buffer (95% buffer - 5% beta-mercaptoethanol) (BioRad). As observed by Ramos-Silva et al ...
-
bioRxiv - Biochemistry 2022Quote: Ceramic hydroxyapatite (CHTTM, type 1, Bio-Rad, Hercules, CA), a crystalline mineral [(Ca5(PO4)3OH)2] with multimodal functionalities ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants were collected and stored at -80 until α5 subunit and its binding partners were immunoprecipitated using SureBeads protein G magnetic beads according to the manufacturer’s protocol (Biorad, Hercules, CA, USA). Western blots (detailed in section 2.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 60 μg purified 6xHis-CNAα copurified with regulatory subunit CNB were resolved by SDS-PAGE and transferred to a nitrocellulose membrane (Bio-Rad, 162-0112). The membrane was stained with Ponceau S solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Beta- and Gammatorquevirus (See Dataset S7) was performed using the CFX96 Real-Time detection system (Bio-Rad) based upon values obtained with a set of purified amplicons used as standards.
-
bioRxiv - Biochemistry 2019Quote: ... Laemmli-type SDS-PAGE gels were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2020Quote: ... and purified on a CHT Ceramic Hydroxyapatite Type II (Biorad) column ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were washed 3 times in TBS-T and incubated for 45 minutes with secondary antibody (Bio-Rad: Goat Anti-rabbit #1706515 or Goat-anti mouse #1706516) ...
-
bioRxiv - Systems Biology 2020Quote: Optical density measurements were taken from each strain type in each media type in triplicate using a SmartSpecTM Plus spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA). 2 µL of stationary-phase culture grown in DMA was added to 2 mL of DMA with final concentrations of either 0 µM ...
-
bioRxiv - Immunology 2023Quote: ... primary B cells were activated as above and then lysed with 4X Laemmli buffer with beta-mercaptoethanol (BioRad) to a final concentration of 1X ...
-
bioRxiv - Microbiology 2020Quote: ... influenza type b serogroup-specific antisera (Bio-Rad., Pastorex™ Meningitis). Streptococcus pneumonia (S ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated cell types were further lysed in 1 ml Purezol (Biorad) to proceed with RNA extraction.
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 2.5% (v/v) beta-mercaptoethanol and ran on a 4-20% TGX gel (BioRad #5671094 and #5671095). Protein was transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti- Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Biochemistry 2021Quote: ... and passed over a Mini CHT hydroxyapatite Type 1 column (Bio-rad). The unbound fraction was collected and concentrated using a Vivaspin 6 (3 kDa MWCO ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4-12% gradient bis-tris gels or 16% tricine gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were reduced in LDS with beta-mercaptoethanol and then polyacrylamide gel electrophoresis was performed on 4-20% Protean Mini TGX gels (Biorad) and transferred to Immobilon PVDF membranes for 15 minutes using mini TGX settings on the Trans-Blot-Turbo system (Biorad) ...