Labshake search
Citations for Bio-Rad :
1 - 50 of 5284 citations for Mouse Relaxin 3 RLN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Two µl of RLN3 peptide were added to the center of a 0.2 μm nitrocellulose membrane (Cat. No.1620146, Bio-Rad, Hercules, CA, USA). Non-specific sites were blocked by incubation with 5% BSA in Tris-buffered saline with 0.1% Tween® 20 detergent (TBS-T ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, BioRad). As secondary antibodies Horseradish Peroxidase (HRP ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Microbiology 2022Quote: ... The Pro Mouse Cytokine 23-Plex Kit (Bio-Rad) was used to measure cytokine and chemokine levels ...
-
bioRxiv - Immunology 2023Quote: ... The Pro Mouse Cytokine 23-Plex Kit (Bio-Rad) was used to measure cytokine and chemokine levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Immunology 2024Quote: The Bio-Plex Pro Mouse Cytokine Standard 23-plex kit (Bio-Rad) was customized to include the following ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... each fiber was carefully submerged in 3 µL of lysis buffer (SingleShot Cell Lysis kit, Bio-rad), containing proteinase K and DNase enzymes to remove unwanted proteins and DNA ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... Bio-Plex Pro Mouse Cytokine 8-plex Assay kit (#M60000007A) (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... Bio-Plex Pro™ mouse cytokine Th1/Th2 assay kit (Bio-Rad, Mississauga, ON, Canada) was used ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... Cytokine levels were estimated using 23-plex-mouse cytokine assay kit following the vendor recommended protocol (Biorad).
-
bioRxiv - Cell Biology 2020Quote: ... and detected using the antibodies listed in Supplementary File 3 with either SuperSignal West Dura or SuperSignal Femto kits (Pierce, Waltham, MA) and a ChemiDoc XRS imaging system (Bio-Rad). Band intensities were quantified using ImageLab software (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... membranes were washed again 3 times 10min in 1X TBS-T and developed using the Clarify Western ECL substrate kit (Bio-Rad) or SuperSignal West Femto (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Zoology 2022Quote: ... sfRNA and 3’UTR were quantified together by RT-qPCR using the iTaq Universal Sybr green one-step kit (Bio-Rad) with primers previously designed [26] ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were then exposed to the ECL substrate kit (Pierce 34850 and 34095) for 3 minutes before imaging with the ChemiDoc Touch Imaging System (Bio-Rad).
-
Maternal n-3 enriched diet reprograms neurovascular transcriptome and blunts inflammation in neonatebioRxiv - Neuroscience 2024Quote: ... Cytokine/chemokine levels were measured using Bio-Plex Pro Mouse Cytokine Standard 31-Plex kit (Cat# 12,009,159, BioRad) on a Bio-Plex 200 analyser as per the manufacturer’s guidelines ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-V5-Tag:DyLight-550 mouse (1:400, Bio-Rad), chicken anti-GFP (1:400 ...
-
bioRxiv - Microbiology 2020Quote: ... HRP-conjugated anti-rabbit and anti-mouse were used for detection using the chemiluminescence detection kit Clarity ECL (Biorad).
-
bioRxiv - Microbiology 2020Quote: Serum cytokines were quantified using the Bio-plex Pro Mouse Cytokine group 1 panel 8-plex kit (Biorad M60000007A). Samples were treated according to the manufacturer’s instructions and acquired on the Bio-Plex® 200 system (Biorad).
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2020Quote: ... Samples were prepared and analyzed using a Bio-Plex Pro Mouse Cytokine 23-Plex Assay kit (Bio-Rad, Hercules, CA). Assays were performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... IL-10) responses were measured using a customized Bio-Plex Pro™ Mouse Cytokine Th1/Th2 Assay kit (Biorad, USA) with the BioPlex 200 platform according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2022Quote: ... Peripheral plasma cytokine levels were determined using Bio-Rad Pro mouse cytokine multiplex commercial kits (Bio-Rad, Montreal, QC, Canada). Also ...
-
bioRxiv - Microbiology 2023Quote: ... fed nymph and mouse bladder samples using the iScript Reverse Transcription supermix kit according to the manufacturer’s instructions (Bio-Rad). Parallel cDNA reactions were carried out in the absence of reverse transcriptase ...
-
bioRxiv - Immunology 2023Quote: ... and IFNγ) by the Bio-Plex Pro Mouse Cytokine Assay kit with the Bio-Plex 200 systems from Bio-Rad Laboratories ...