Labshake search
Citations for Bio-Rad :
1 - 50 of 10000+ citations for Mouse 14 3 3 protein sigma SFN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, BioRad). As secondary antibodies Horseradish Peroxidase (HRP ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Microbiology 2019Quote: ... and plates were read 3 times at 450 nm in the model microplate ELISA reader (BIO-RAD, Japan). Negative controls (coated with naive sera ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 3 uL Precision Plus Protein All Blue prestained standards (Bio-Rad, #1610373) loaded as a ladder ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... kinase-dead extracts were incubated 3 consecutive times with protein A-beads (Bio-Rad) previously coated with the anti-B55δ antibody (1 hour incubation at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μg of the protein samples were prepared with 4X Laemmli loading buffer (Biorad) and denatured at 95°C for 5 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... The 3 mg/mL protein sample was injected onto NGC Liquid Chromotography System (Bio-Rad) equipped with a HiPrep Sephacryl S-500 HR column equilibrated in FPLC buffer and separated into 156 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by 3-8% or 8-16% SDS-PAGE (NU-PAGE or BioRad) and transferred to immobilon-P membranes (Millipore) ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 3 µg protein was separated by SDS-PAGE gel electrophoresis (Bio-Rad) and transferred to 0.2 µm nitrocellulose membrane (Amersham™ Protran™ ...
-
bioRxiv - Microbiology 2023Quote: ... 40 µg of proteins were loaded onto 3–8% precast polyacrylamide gel (Bio-Rad, 3450129). After migration ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 final 10-minute TBST washes were followed by visualization of proteins with ECL (BioRad, 11705062). Densitometry analysis was performed using ImageLab 6.0 software (BioRad ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼3 million cells were harvested and proteins were extracted by boiling in 2x Laemmli sample buffer (BioRad). Protein levels were measured by Western blotting with different antibodies (Rabbit anti- BRWD3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Proteins were separated by 14% SDS-PAGE and transferred to PVDF membranes (Biorad). Following blocking in 5% Milk (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Microbiology 2022Quote: ... Proteins were separated using a gradient SDS PAGE gel (8-12%) and a Mini-Protean 3 Cell (Bio-Rad) at 85 V ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...