Labshake search
Citations for Bio-Rad :
1 - 50 of 692 citations for LAG 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... mouse-anti His (BIO-RAD; MCA1396GA), mouse-anti p65 (F-6 ...
-
bioRxiv - Microbiology 2023Quote: ... A mouse anti-His antibody (Biorad) was used as a primary antibody in a 1:500 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tagged protein was detected using a mouse anti-6×His IgG conjugated to horseradish peroxidase (MCA1396P; Bio-Rad), and the blot was developed using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2020Quote: ... 12.5 μL of SensiMix SYBR Hi-ROX (BIO-RAD) and DNAse/RNAse free water up to 15 μL ...
-
bioRxiv - Microbiology 2023Quote: ... and an anti-His-HRP conjugate antibody (Bio-Rad) was used in a 1:4000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... or His-tag antibody (MCA1396, Bio-Rad, 1:1000), or rabbit monoclonal β-actin antibody (D6A8 ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs) ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal His tag antibody (MCA1396GA, Bio-Rad, 1:1000), mouse 2A antibody (NBP2-59627 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were transfected by electroporation in OPTI-MEM I using Gene-Pulser II (Bio-Rad) with 960 μF und 0.18 kV with 10 μg pcDNA3-FLAG-JUNB ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation with mouse anti-His (1:1000, BioRad MCA1396GA) overnight at 4 °C and secondary antibody detection with IRDye800CW anti-mouse (1:5000 ...
-
bioRxiv - Microbiology 2024Quote: ... PorH-His immunoblots were performed on 16.5% tris-tricine gels (BioRad) using anti-His (mouse ...
-
bioRxiv - Plant Biology 2022Quote: ... Imaging was done using Hi-sensitivity chemiluminescence settings under ChemiDoc XRS+ (BioRad).
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
bioRxiv - Neuroscience 2020Quote: ... 15 μg total RNA from HEK293 cells were separated on 5% Criterion™ TBE polyacrylamide gels (#3450048, Bio-Rad) and transferred to positively charged nylon membrane ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant His-tagged proteins were purified using a 5 mL IMAC column (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... the His-FUS proteins were mixed with Profinity IMAC Ni2+-charged resin (Bio-Rad) for 30 min at 20 °C ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Plant Biology 2020Quote: ... The His-tagged fusion protein was purified using a Ni-NTA column (Bio-Rad, USA). Protein was eluted in elution buffer [500 mMNaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... and then evaluated by immune-decoration analysis using a monoclonal His-antibody (AbHis, Bio-rad). Pichia transformants expressing FHS-CELLOX was already available (Scortica et al. ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was then incubated with mouse anti-His antibody (catalog number #6200203, Bio-Rad), diluted 1:1,000 in the blocking solution and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Detection of His-tagged proteins was performed with the ClarityTM Western ECL substrate (Biorad, USA) and using a Versadoc (Biorad ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Systems Biology 2021Quote: ... Quantitative analyses of blotted hCDKL5 and His-Neuropinilin were carried out with Image Lab software (BioRad) and the volumetric yield was derived considering the final biomass concentration (OD600 ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed and incubated with mouse anti-His (Bio-Rad MCA-1396; 1:1000) followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody (MerckMillipore AP124P ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Colorimetric (standards) and chemiluminescent detection (His-tagged proteins) were performed using the ChemiDoc Imager (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated for at least 16 hours at 4°C with either mouse monoclonal anti-His (1:2,000; AD1.1.10, Biorad) or mouse anti-RNA pol (1:5,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... and the protein was passed through Hi-Q anion exchange column (Bio-Rad Laboratories, Hercules, CA, USA) to remove minor nucleic acid contamination ...
-
bioRxiv - Plant Biology 2021Quote: Purified His and GST fusion proteins or GST alone (500 ng) were blotted onto nitrocellulose membrane (BioRad). The nitrocellulose membrane was rinsed with TBS-T buffer (10 mM Tris-HCl at pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... Eluents were collected and incubated with 50μL of packed Ni-NTA resin (Bio-Rad His-Pur 88222) at room temperature with nutating for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cultures were induced with IPTG and His-MBP-ORC2 was purified on Ni-NTA beads (BioRad). Purified protein was injected into rabbits for serum generation and collection (Cocalico Biologicals) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged σs was added to phosphorylated/unphosphorylated RssB in Micro Bio-Spin Chromatography columns (Bio-Rad) before removing 6μL of the input for SDS-PAGE analysis and adding 40μL of prepared HisPur Ni-NTA resin (Thermo Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... was used to purify the C-terminal 6X-His EfgA with 1 mL Ni-NTA columns (Bio-Rad). Columns were equilibrated with 10 mL of Buffer A at 1 mL/min prior to loading lysates ...