Labshake search
Citations for Bio-Rad :
1 - 50 of 1442 citations for IL 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, BioRad). As secondary antibodies Horseradish Peroxidase (HRP ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... The membrane was incubated with a primary mouse anti-pig IL-18 antibody (diluted 1:500, Bio-Rad) or anti-β-actin antibody (diluted 1:500 ...
-
bioRxiv - Immunology 2023Quote: IL-27 plasma levels were assessed using the Mouse Cytokine 23-Plex immunoassay (Bio-Rad Laboratories, Inc., CA, USA) and by the IL-27 Mouse ELISA kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... IL-10) responses were measured using a customized Bio-Plex Pro™ Mouse Cytokine Th1/Th2 Assay kit (Biorad, USA) with the BioPlex 200 platform according to the manufacturer’s guidelines ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants of lung homogenates used for cytokine analysis were stored at −80 with 1x Pierce Proteinase Inhibitor until testing using Bio-Plex Pro Mouse Cytokine Th17 Panel A with additional GM-CSF and IL-12p70 Singleplex sets on a Bio-Plex200 Platform (BioRad). Cytokine levels were normalized against total protein measured by Bradford assay.
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The concentrations of mouse and human IL-6 and TNF-α were determined by a multiplex Bio-Plex assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... CD45R0-A647 (clone IL-A116, Biorad), Beta7-RPE (clone FIB27 ...
-
bioRxiv - Immunology 2020Quote: ... IL-17F and IL-10 were measured using a Luminex based method using Bioplex reagents from BioRad.
-
bioRxiv - Immunology 2021Quote: ... IL-18 and IL-6 concentrations were measured using the Bio-Plex Pro Human Cytokine Assay (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... We used the Evagreen (BioRad, IL USA) approach as described previously (88) ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 and IL-17 with housekeeping gene β-actin mRNA by qPCR using the iQ™ SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA). Forward and reverse primers and PCR conditions for RT-PCR are listed in Table 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Bevacizumab (HCA182) and CD126/IL-6R (AHP2449) were obtained from Biorad.
-
bioRxiv - Cancer Biology 2023Quote: ... iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems were used to perform qPCR.100ng of cDNA was used per RT-PCR reaction ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Microbiology 2019Quote: ... and IL-1 β were measured with Bio-Plex® custom Assay (BIORAD) using a Bio-plex 200 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-V5-Tag:DyLight-550 mouse (1:400, Bio-Rad), chicken anti-GFP (1:400 ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Des Plaines, IL). Assay of RNA via quantitative PCR [qPCR] was performed with iTaq universal SYBR green supermix (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR was conducted using iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined with the Bradford quantification assay (Bio-Rad Laboratories, Des Plaines, IL, USA), using BSA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using a Micro Bradford Protein Assay Kit (Bio-Rad, Rockford, IL, USA). Samples with equal quantities of protein (50 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-CD8 (Biorad:MCA1226GA) 10 µg ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-Mouse HRP (BioRad) was used as a secondary detection antibody and immunoblots were developed with Forte HRP substrate (Millipore ...
-
bioRxiv - Immunology 2019Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...
-
bioRxiv - Immunology 2020Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...