Labshake search
Citations for Bio-Rad :
1 - 50 of 686 citations for IL 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... IL-18 and IL-6 concentrations were measured using the Bio-Plex Pro Human Cytokine Assay (BioRad).
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Immunology 2020Quote: ... The concentrations of mouse and human IL-6 and TNF-α were determined by a multiplex Bio-Plex assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: We used conjugated magnetic beads (6.5 μm) (Bio-Plex Pro Human Chemokine IL-8 / CXCL8 Set #171BK31MR2, BioRad, Hercules, CA, USA) for the binding assay ...
-
bioRxiv - Microbiology 2024Quote: ... IL-28A/IFN-λ2 and IL-29/IFN-λ1) using a Bio-Plex ProTM Human Inflammation Panel 1 Express assay (Bio-Rad Laboratories Ltd. ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... CD45R0-A647 (clone IL-A116, Biorad), Beta7-RPE (clone FIB27 ...
-
bioRxiv - Immunology 2020Quote: ... IL-17F and IL-10 were measured using a Luminex based method using Bioplex reagents from BioRad.
-
bioRxiv - Microbiology 2021Quote: ... We used the Evagreen (BioRad, IL USA) approach as described previously (88) ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 and IL-17 with housekeeping gene β-actin mRNA by qPCR using the iQ™ SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA). Forward and reverse primers and PCR conditions for RT-PCR are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Bevacizumab (HCA182) and CD126/IL-6R (AHP2449) were obtained from Biorad.
-
bioRxiv - Cancer Biology 2023Quote: ... iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems were used to perform qPCR.100ng of cDNA was used per RT-PCR reaction ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Microbiology 2019Quote: ... and IL-1 β were measured with Bio-Plex® custom Assay (BIORAD) using a Bio-plex 200 ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...