Labshake search
Citations for Bio-Rad :
1 - 50 of 2069 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... FITC-conjugated integrin β1 (CD29, HM beta 1-1, #MCA2298) and FITC-conjugated integrin β3 (CD61, #MCA2299) were from Bio-Rad (Oxford, UK). CHRONO-LUME® was from Chrono-log Corporation (Labmedics ...
-
bioRxiv - Microbiology 2023Quote: ... or His-tag antibody (MCA1396, Bio-Rad, 1:1000), or rabbit monoclonal β-actin antibody (D6A8 ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal His tag antibody (MCA1396GA, Bio-Rad, 1:1000), mouse 2A antibody (NBP2-59627 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... A SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Cell Biology 2023Quote: ... for Integrin β2 using a ChemiDoc (Bio-Rad) imaging system.
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Integrin β3 and Clarity-Max ECL (Bio-Rad, 1705062) for Integrin β2 using a ChemiDoc (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2019Quote: ASM and AIM proteins were dissolved in 2X Laemmli buffer (95% buffer - 5% beta-mercaptoethanol) (BioRad). As observed by Ramos-Silva et al ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant His-tagged proteins were purified using a 5 mL IMAC column (Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2022Quote: ... anti-alpha-Tubulin (VMA00051, BIO-RAD), anti-Lamin B1 (66095-1-Ig ...
-
bioRxiv - Cell Biology 2020Quote: ... alpha-Tubulin (BioRad MCA78G, 1:2000), Cdc20 (Santa Cruz sc-8358 ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... rat anti-alpha Tubulin (1:500 Bio-Rad), rabbit anti-NudE/NudEL antibody (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... rat anti-alpha tubulin (1:1000, Bio-Rad). All primary antibodies were incubated overnight at 4°C with shaking ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Microbiology 2022Quote: ... mouse-anti His (BIO-RAD; MCA1396GA), mouse-anti p65 (F-6 ...
-
bioRxiv - Microbiology 2023Quote: ... A mouse anti-His antibody (Biorad) was used as a primary antibody in a 1:500 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... we used primary alpha-tubulin rat antibody (Bio-rad) diluted 1:200 in 1% BSA in PBS for 1.5 hours at room temperature and secondary antibody anti-rat Alexa Fluor 647 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... and beta mercaptoethanol (0.05 M, BioRad Laboratories Cat#1610710) and loaded into a NuPAGE 4%–12% or 10% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 10% beta-mercaptoethanol (BME) (Bio-Rad 161-0710) was added to 15µg of total protein.
-
bioRxiv - Microbiology 2023Quote: ... and 0.25ul of beta-mercaptoethanol (Bio-Rad #161-0710) and boiling the reaction at 100C for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoblot detection of 6xHIS and 2A peptide tags were determined through anti-Histidine tag (AD1.1.10, Biorad) and anti-2A peptide (3H4 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Synthetic Biology 2023Quote: ... The blocking buffer was removed and 10 ml 5% BSA-PBST with 1 μl RABBIT anti-DYKDDDDK Tag antibody (Bio-Rad, # AHP1074), 1 μl anti-MBP Monoclonal Antibody (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-Strep-tag antibody from Biorad, the anti-rabbit IgG-HRP and anti-mouse IgG-HRP antibodies from GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: - Mouse anti-V5 tag (Bio-Rad, MCA1360) used at dilution 1:5000 for Western Blot
-
bioRxiv - Genomics 2023Quote: - Mouse anti-V5 tag (Bio-Rad, MCA1360) used at dilution 1:5000 for Western Blot
-
bioRxiv - Biochemistry 2020Quote: ... His-tagged protein was detected using a mouse anti-6×His IgG conjugated to horseradish peroxidase (MCA1396P; Bio-Rad), and the blot was developed using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)