Labshake search
Citations for Bio-Rad :
1 - 50 of 4530 citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Immunology 2023Quote: ... and chemokines dosage by Luminex using the 48-Plex pan-human cytokine kit (BioRad) according to the manufacturer procedure ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the Bio-Plex Pro™ Human Inflammation Panel-1 Kit (37-Plex, Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Immunology 2024Quote: ... 17 human cytokines were analysed simultaneously using the kit and run on the Luminex analyser (BIORAD), standard curves for each cytokine created and per cytokine concentrations calculated using the BioRad software.
-
bioRxiv - Immunology 2024Quote: Cytokines were measured in cell culture supernatants using luminex analysis (Biorad human 17-plex Bioplex kit) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Physiology 2023Quote: ... each fiber was carefully submerged in 3 µL of lysis buffer (SingleShot Cell Lysis kit, Bio-rad), containing proteinase K and DNase enzymes to remove unwanted proteins and DNA ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Neuroscience 2022Quote: Cytokines were quantified in media isolated from MN cultures using the Bio-Plex Pro Human Cytokine kit (Biorad, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: The details of the protein purification protocol for human plasma sample are described in the Aurum serum mini kit leaflet and a detailed was followed(BioRad, USA). The sample was prepared for 2-D gel electrophoresis following passive rehydration for 16-24 h ...
-
bioRxiv - Genomics 2020Quote: ... The concentrations of cytokines in plasma were measured using the Bio-Plex Pro™ Human Cytokine 17-plex Assay kit immunoassay run on the Bio-Plex 200 (BioRad), with reference to an 8 point standard curve.
-
bioRxiv - Immunology 2021Quote: ... Serum was also collected for cytokine analyses which were performed by the University of Pennsylvania’s Human Immunology Core using a Non-Human Primate Cytokine Panel kit (MilliporeSigma, Cat# PCYTMG-40K-PX23) on a Bio-Plex 200 instrument (Bio-Rad) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: Plasma from each patient sample was analyzed using the Bio-Plex Pro™ Human Cytokine 17-plex Assay kit (Bio-Rad). Cytokine expression was measured using the Luminex xMAP® (Luminex Corporation ...
-
bioRxiv - Immunology 2021Quote: ... Sera were collected for cytokines analyses which were performed by the Macau University of Science and Technology using a Non-Human Primate Cytokine Panel kit (MilliporeSigma, Cat# PCYTMG-40K-PX23) on a Bio-Plex 200 instrument (Bio-Rad) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Cancer Biology 2024Quote: Serum cytokines were measured using the Luminex xMAP technology on the Bio-Plex 200 platform (Bio-plex Manager 5.0) with the Bio-Plex Pro™ Human Cytokine Screening Test Kit (48-Plex, Bio-Rad) and the Bio-Plex Pro™ Human Inflammation Panel-1 Kit (37-Plex ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... Multiplexed cytokine measurements on macrophage cell culture supernatants were performed using a custom Bio-Plex Express Human Cytokine kit (Bio-Rad 17004073) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Cell Biology 2020Quote: ... and detected using the antibodies listed in Supplementary File 3 with either SuperSignal West Dura or SuperSignal Femto kits (Pierce, Waltham, MA) and a ChemiDoc XRS imaging system (Bio-Rad). Band intensities were quantified using ImageLab software (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... membranes were washed again 3 times 10min in 1X TBS-T and developed using the Clarify Western ECL substrate kit (Bio-Rad) or SuperSignal West Femto (ThermoFisher Scientific) ...