Labshake search
Citations for Bio-Rad :
1 - 50 of 657 citations for Glypican 3 GPC3 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in FACS buffer with Fc-block (Human Seroblock, Bio-Rad). These samples were then re-pelleted and suspended in a cocktail of fluorophore-conjugated primary antibodies (Supp ...
-
bioRxiv - Immunology 2020Quote: ... The binding was detected by an HRP-conjugated anti-human IgG (Fc) CH2 Domain antibody (Bio-Rad MCA647P) used at a 1:5,000 dilution at RT for 1 h and developed as described above.
-
bioRxiv - Cell Biology 2020Quote: ... FCS was chelated with Chelex-100 resin (BioRad) and added to Ca2+ free FAD medium ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs) ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were transfected by electroporation in OPTI-MEM I using Gene-Pulser II (Bio-Rad) with 960 μF und 0.18 kV with 10 μg pcDNA3-FLAG-JUNB ...
-
bioRxiv - Immunology 2023Quote: ... mice receive daily intradermal injections of CSF1-FC (Bio-Rad; PPP031) or PBS in contralateral hind paws (5µl per paw ...
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
bioRxiv - Neuroscience 2020Quote: ... 15 μg total RNA from HEK293 cells were separated on 5% Criterion™ TBE polyacrylamide gels (#3450048, Bio-Rad) and transferred to positively charged nylon membrane ...
-
bioRxiv - Physiology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g,5 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% chelated FCS (Chelex 100 molecular biology grade resin, BioRad, USA), 1% penicillin/streptomycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2023Quote: ... RBD-Fc then purified by gravity flow using Econo-Glass column (BioRad, California, USA). RBD-Fc elution was performed using 0.1 M glycine (pH2.2 ...
-
bioRxiv - Microbiology 2024Quote: ... then visualized on the Odyssey Fc (LICOR) using Clarity Western ECL Substrate (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... purified RBD-Fc proteins were concentrated using 10,000 MWCO Amicon centrifugation columns (BioRad, California, USA) and stored at 4°C before use ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... a bottom layer containing RPMI 1640 medium (10% CS-FCS) and 0.75% low melting agar (Bio-Rad) was overlain with half the volume of RPMI 1640 medium (10% FCS ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Immunology 2023Quote: ... to block Fc receptors and stained with biotinylated anti-mouse F4/80 (clone: Cl:A3-1, cat:MCA497B, BIO-RAD), PerCP-Cy5.5-conjugated streptavidin (551419 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.