Labshake search
Citations for Bio-Rad :
1 - 50 of 6505 citations for Cow Upstream stimulatory factor 1 USF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... epidermal growth factor (Serotec/Bio-Rad, EGF-1), hydrocortisone (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Expression of negative co-stimulatory molecules together with β-actin and GAPDH endogenous controls were analyzed using CFX96 Touch Real-Time system (BIO-RAD Inc.) in 96-well MicroAmp® optical fast-plates (Applied Biosystems® ...
-
bioRxiv - Systems Biology 2023Quote: ... and Growth Factor Assay (Biorad) and the Bio- Plex Pro TGFβ Assay (Biorad ...
-
bioRxiv - Cell Biology 2020Quote: The ddPCR primer mix for amplifying upstream of the sgRNA integration region was purchased from BioRad: Gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattct gcagacaaatggcagtattcatccacaattttaaaagaaaagggggg (FAM ...
-
bioRxiv - Immunology 2020Quote: Multiplex ELISA (Biorad; CA, USA) was performed to detect cytokines in BALF ...
-
bioRxiv - Microbiology 2019Quote: ... Factor H protein was purchased from Biorad and the mouse monoclonal IgG1 Factor H Antibody (OX24 ...
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... then measured the volume of TFEB signal upstream and downstream of this front for each condition using ImageLab (Bio-rad). We then measured the ratio of the downstream volume (less phosphorylated ...
-
bioRxiv - Molecular Biology 2022Quote: ... ELISAs were performed with the Bio-Rad TeSeE Short Assay Protocol (SAP) Combo Kit (BioRad Laboratories Inc., Hercules, CA, USA). Importantly ...
-
bioRxiv - Microbiology 2022Quote: ... The absorbance was read using ELISA reader (BIO-RAD). The detection ranges for TNF-α ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA reading was taken in iMark plate reader (BioRad). Standard curve was generated from ODs of known dilutions of NS1-Ag ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the miR200c primers (upstream primer, 5’- TAATACTGCCGGGTAATGATGGA-3’) (Eurofins Genomics) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). U6 primers (TAKARA ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates were read on iMark™ Microplate Reader (BioRad) and data analyzed with Excel.
-
bioRxiv - Microbiology 2023Quote: ... and the absorbance was read using an ELISA reader (BIO-RAD) at 450 nm and 570 nm dual filters.
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were read on a model 680 microplate reader (Bio-Rad) at 450 nm.
-
bioRxiv - Microbiology 2020Quote: ... This was read at 540 nm on an ELISA reader (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... a sandwich ELISA was performed using a matched antibody pair (BioRad, France) as previously described (Totté et al. ...
-
bioRxiv - Microbiology 2023Quote: ... GM testing with the Platelia enzyme-linked immunosorbent assay (ELISA) (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... PP2A activity was measured using an ELISA reader (Bio-rad xMARK microplate spectrometer) at a wavelength of 650 nm.
-
bioRxiv - Synthetic Biology 2021Quote: ... OD490nm was determined using a microplate reader (iMark ELISA plate reader, Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... ELISA-based signaling measurements were performed according to the manufacturer’s instructions (Bio-Rad). The Luminex kits EGFR Y1068-p and p-AKT is S473-p were obtained from Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance of the suspension was measured at 570nm using ELISA plate reader (BioRad, USA). Cellular cytotoxicity was determined in duplicates and each experiment was repeated thrice independently.
-
bioRxiv - Immunology 2021Quote: ... The absorbance at 450 nm was measured by an ELISA plate reader (Bio-Rad). The endpoint serum dilution was calculated with curve fit analysis of optical density (OD ...
-
bioRxiv - Immunology 2023Quote: ... The plates were developed with TMB ELISA substrate solution (Bio-Rad Laboratories, Hercules, CA) and stopped using 1 N sulfuric acid ...
-
bioRxiv - Physiology 2023Quote: ... taking into account dilution factor (cell count estimated with the BIO-RAD TC20 automated cell counter). Repeatability of the ROS production measurements between sample-duplicates was R = 0.924 (CI 95% = [0.9 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Microbiology 2020Quote: ... vascular endothelial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... Optical density (OD) was immediately read at 450 nm using an ELISA plate reader (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: Cytokine and growth factor secretion was measured with the Bio-Plex Pro Human Cytokine Screening Panel (Bio-Rad #M500KCAF0Y), a 27-plex assay ...
-
bioRxiv - Biochemistry 2019Quote: ... Carboxylation of matrix Gla protein was determined as for the factor IX single turnover assay except for use of a Criterion 16.5% TRIS/TRICINE gel (BioRad) with [14C]fIX -18/+41 standards for quantization ...
-
bioRxiv - Microbiology 2021Quote: ... Optical densities (OD) were measured at 450 nm using an ELISA plate reader (Spectrophotometer Bio-Rad Xmark). Cut-off values were assessed as the average OD plus two standard deviations obtained from serum (n = 100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2019Quote: ... and plates were read 3 times at 450 nm in the model microplate ELISA reader (BIO-RAD, Japan). Negative controls (coated with naive sera ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Immunology 2021Quote: ... the OD values were read at 450/620 nm by an ELISA plate reader (Bio-Rad, Hercules, CA).
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using Bradford Assay Kit 1 (Bio-Rad) and 30µg of protein were loaded onto 8% SDS-Page Gels (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A gate was established for each factor using negative control samples stained with mouse IgG1 negative control antibodies (BIO-RAD, MCA928) or polyclonal rabbit IgG (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... and growth factor protein expression was quantified using the Bio-Plex Pro Rat Cytokine 23-plex assay (Bio-Rad Laboratories, Inc). Analytes included in the assay were ...
-
bioRxiv - Physiology 2021Quote: ... chemokines and growth factors were quantitated by using a Bio-Plex Pro Mouse 23-plex Immunoassay and Bio-Plex Reader System (Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Bioengineering 2022Quote: Total RNA was purified with 1) Aurum Total Mini Kit (Bio-Rad) using the spin column method with DNase 1 (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad; Cat#1864022) and same set of primers and probe used for SIV plasma viral load quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad)) and the cDNA was purified with QiaQuick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA (1 μg) was reverse transcribed using the SuperScript kit (BioRad), and the Real-time PCR was performed in three technical replicates using the Applied Biosystems StepOnePlus Real-Time PCR system and Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... then embedded in 1% low-melt agarose blocks (BioRad Plug Kit #1703591) to preserve DNA integrity ...