Labshake search
Citations for Bio-Rad :
1 - 50 of 190 citations for CD40L Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...