Labshake search
Citations for Bio-Rad :
1 - 50 of 1471 citations for Beta Glucuronidase GUSB Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µL 20x GUSB Reference Assay (ID dHsaCPE5050189, Bio-Rad, Hercules, CA), 6 µL cDNA ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... and beta mercaptoethanol (0.05 M, BioRad Laboratories Cat#1610710) and loaded into a NuPAGE 4%–12% or 10% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 10% beta-mercaptoethanol (BME) (Bio-Rad 161-0710) was added to 15µg of total protein.
-
bioRxiv - Microbiology 2023Quote: ... and 0.25ul of beta-mercaptoethanol (Bio-Rad #161-0710) and boiling the reaction at 100C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... A SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples ...
-
bioRxiv - Immunology 2022Quote: ... with beta-mercaptoethanol and run using a Mini-PROTEAN Electrophoresis and Transfer system (BioRad). Membranes were incubated with primary antibody overnight at 4°C (ME1 ...
-
bioRxiv - Physiology 2023Quote: ... We normalized the protein bands to beta-tubulin with Image Lab software (Bio-Rad). For citrate synthase activity ...
-
bioRxiv - Immunology 2022Quote: TGF-beta isoforms were measured with the Bio-Plex Pro TGF-β assays (Bio-Rad) in accordance with manufactures directions ...
-
bioRxiv - Neuroscience 2022Quote: ... input and precipitated samples were prepared in 5x SDS buffer containing beta-mercaptoethanol (Bio-Rad) and boiled for 5 minutes at 90° C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ASM and AIM proteins were dissolved in 2X Laemmli buffer (95% buffer - 5% beta-mercaptoethanol) (BioRad). As observed by Ramos-Silva et al ...
-
bioRxiv - Microbiology 2020Quote: ... Beta- and Gammatorquevirus (See Dataset S7) was performed using the CFX96 Real-Time detection system (Bio-Rad) based upon values obtained with a set of purified amplicons used as standards.
-
bioRxiv - Immunology 2023Quote: ... primary B cells were activated as above and then lysed with 4X Laemmli buffer with beta-mercaptoethanol (BioRad) to a final concentration of 1X ...
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 2.5% (v/v) beta-mercaptoethanol and ran on a 4-20% TGX gel (BioRad #5671094 and #5671095). Protein was transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4-12% gradient bis-tris gels or 16% tricine gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were reduced in LDS with beta-mercaptoethanol and then polyacrylamide gel electrophoresis was performed on 4-20% Protean Mini TGX gels (Biorad) and transferred to Immobilon PVDF membranes for 15 minutes using mini TGX settings on the Trans-Blot-Turbo system (Biorad) ...
-
bioRxiv - Physiology 2021Quote: ... and proteins were stripped from beads by incubation in gel loading buffer with beta-mercaptoethanol and loaded to 4-15 % gels (Criterion; BioRad) for SDS-PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4–12% gradient bis-tris gels (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... The production of carbapenemase was tested by combination disc test method (EUCAST 2017) and biochemical tests (BioRad-Beta-Carba test) while carbapenem hydrolysis was tested by MALDI-TOF (Papagiannitsis et al. ...
-
bioRxiv - Immunology 2022Quote: ... and the primers for murine IFNAR 1 and beta-Actin in a MyiQ™ Single-Color Real-Time PCR System (BioRad). Products of RT-PCR were separated by electrophoresis on a 2.5% agarose gel in 1x TBE buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Immunology 2019Quote: Mouse patellofemoral joints and hearts were homogenized using an electric homogenizer with toothed blades in tissue lysis buffer (Machery-Nagel, 740962) containing beta-mercaptoethanol (1:100) (Bio-Rad, 161-0710) and Triton-X-100 (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC-conjugated integrin β1 (CD29, HM beta 1-1, #MCA2298) and FITC-conjugated integrin β3 (CD61, #MCA2299) were from Bio-Rad (Oxford, UK). CHRONO-LUME® was from Chrono-log Corporation (Labmedics ...
-
bioRxiv - Neuroscience 2021Quote: ... Target proteins were detected by chemiluminescence with Clarity™ (Beta-actin and GFP) and Clarity Max™ (SP) Western ECL Substrate kit (Bio-Rad®) on the Odyssey FC system (LI-COR) ...
-
bioRxiv - Neuroscience 2019Quote: ... or BIC (20 μM) were added to the culture and cells were harvested with a 1:1 mixture of 2X Laemmeli buffer (BioRad, 1610737, 1:20 beta-mercaptoethanol) and radioimmunoprecipitation assay (RIPA ...
-
bioRxiv - Cell Biology 2021Quote: ... coli antibodies (1:100, Bio-Rad Antibodies, 4329-4906), followed by DyLight 650-conjugated donkey anti-rabbit IgG antibodies (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-Gapdh antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 0.1% Tween-20 in 1x PBS (PBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies were detected using horseradish-peroxidase conjugated anti-rabbit antibodies (BioRad) and detected with Western Lightning ECL reagents.
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... coli antibodies (BioRad, ON) or rabbit anti-Salmonella O antiserum group B antibodies (Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... α-StrepTag antibodies (Biorad). After transferring to nitrocellulose membrane ...
-
bioRxiv - Immunology 2021Quote: ... Virus plaques were visualised by immunostaining with a rabbit polyclonal anti-NSP8 antibody (ABIN233792; Antibodies Online) and an HRP-conjugated anti-rabbit antibody (1706515; Bio-Rad). Plaques were quantified and IC50 values calculated using LabView or SigmaPlot software as previously described (28) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plaques of FCoV were stained with specific antibodies (primary antibody: mouse anti feline coronavirus monoclonal antibody at 1:500 dilution solution, Bio-Rad; secondary antibody ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies were detected using HRP- conjugated secondary antibodies (Bio-Rad, 1:5,000) and ECL (ThermoFisher Pierce) ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody overnight and with secondary antibody (goat anti-mouse IgG-HRP (#1706516, Biorad) for 1h ...
-
bioRxiv - Neuroscience 2020Quote: ... Final panning using antibodies against Thy1.2 (CD90.2) (#MCA02R; Bio-Rad Antibodies, Hercules, CA) positively selected for RGCs ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with a secondary antibody (1:3000 HRP–linked Anti-Rabbit antibody Bio-Rad) and protein bands were visualized with SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermofisher Scientific #34580 ...
-
bioRxiv - Neuroscience 2021Quote: ... For MARCO and TLR2 antibody blockade either 0.8 µg of MARCO antibody (Bio-Rad) 34 ...
-
bioRxiv - Physiology 2021Quote: ... Secondary antibodies goat anti-mouse HRP-linked secondary antibodies (Bio-Rad, Hercules, CA, USA) and goat anti-rabbit HRP-linked secondary antibodies (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antibodies used for SBA: Alexa 488 labeled mouse anti-human CD9 antibody (MCA469A488, Biorad), PE-labeled mouse anti human CD63 antibody (12-0639-42 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The secondary antibody was a goat anti-rabbit antibody conjugated to horseradish peroxidase (BioRad). Bound antibody was visualized by incubation in Clarity ECL substrate (BioRad ...