Labshake search
Citations for Bio-Rad :
1 - 50 of 835 citations for Beta Actin Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and the primers for murine IFNAR 1 and beta-Actin in a MyiQ™ Single-Color Real-Time PCR System (BioRad). Products of RT-PCR were separated by electrophoresis on a 2.5% agarose gel in 1x TBE buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Target proteins were detected by chemiluminescence with Clarity™ (Beta-actin and GFP) and Clarity Max™ (SP) Western ECL Substrate kit (Bio-Rad®) on the Odyssey FC system (LI-COR) ...
-
bioRxiv - Microbiology 2020Quote: ... Detection via secondary antibody was done with goat α-rabbit mAb (1:5000) conjugated to HRP (Biorad). Immunoblots were developed using the SuperSignal West Femto (Thermo ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... mAb-Daxx MCA2143 (Bio-Rad), pAb-ATRX H300 (Santa Cruz) ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-V5 mAb (Biorad, Hercules ...
-
bioRxiv - Biochemistry 2021Quote: ... Actin (BioRad, 12004163).
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... and beta mercaptoethanol (0.05 M, BioRad Laboratories Cat#1610710) and loaded into a NuPAGE 4%–12% or 10% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 10% beta-mercaptoethanol (BME) (Bio-Rad 161-0710) was added to 15µg of total protein.
-
bioRxiv - Microbiology 2023Quote: ... and 0.25ul of beta-mercaptoethanol (Bio-Rad #161-0710) and boiling the reaction at 100C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... A SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples ...
-
Trypanosoma brucei colonises the tsetse gut via an immature peritrophic matrix in the proventriculusbioRxiv - Microbiology 2019Quote: ... mAb 9G4 (mouse anti-GPEET unphosphorylated form, Biorad) 1:200 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... and PE-conjugated anti-CD21 mAb (Biorad, CA2.1D6)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ms mAb to Vinculin (Bio-Rad Cat#MCA465GA), Ms McAb to GAPDH (Proteintech Cat#60004-I-Ig) ...
-
bioRxiv - Immunology 2020Quote: ... and IgM-PE mAb (clone K52 1C3, BioRad Antibodies ...
-
bioRxiv - Genomics 2022Quote: ... anti- actin Rhodamine (Biorad 12004163), rabbit anti-SMIM4 (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... β-actin (1:5000, BioRad HCA147P), α-tubulin (1:2000 ...
-
bioRxiv - Biophysics 2023Quote: ... Strep-tagged recombinant (BioRad, 1610363). The gel image was acquired with ChemiDoc Imaging Systems (BioRad ...
-
bioRxiv - Developmental Biology 2019Quote: ... monomeric ATP-bound 2 μM rabbit muscle actin was treated overnight at 4°C with analytical grade anion exchange resin (BioRad), hexokinase (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... For the three MuSK-specific (mAb MuSK1A, MuSK1B and MuSK3-28) and AChR-specific mAb 637 Mini-PROTEAN® TGX Stain-Free™ Precast Gels (Biorad) and Laemmli Sample Buffer (Biorad ...
-
bioRxiv - Immunology 2020Quote: ... and CD8β-FITC mAb (clone PPT23, Bio-Rad Antibodies). Following fixation (Fixation Buffer ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-γ-actin (#MCA5776GA, Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... β-Actin (Bio-Rad 12004163, 1:10,000) was used as a loading control ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-β-actin (#MCA5775GA, Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-γ-actin (#MCA5776GA, Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Anti-Actin (Bio-Rad, 12004163) antibodies were used at 1:4000 and 1:2000 respectively for loading controls as indicated.
-
bioRxiv - Immunology 2023Quote: ... PE-conjugated anti-Foxp3 mAb (clone FJK-16s, eBioscience™, 1:20) and/or Alexa Fluor 647-conjugated anti CD3 mAb (clone CD3-12, Bio-Rad, 1:100) were added directly to cells and incubated for 40 min ...
-
bioRxiv - Bioengineering 2019Quote: ... and mAb production using NGC system (Bio-Rad, Hercules, CA). The anti-SSTR2 mAb was purified using our two-step antibody purification protocol by the NGC system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: hFAB Rhodamine anti-Actin (Bio-Rad, 12004166); (1:10,000)
-
bioRxiv - Immunology 2022Quote: ... Biotinylated mouse anti-bovine IFN-γ mAb (CC302; Bio-Rad Antibodies) diluted to 0.5µg/mL in carrier buffer was added (100 µL/well ...
-
bioRxiv - Immunology 2021Quote: ... The F4/80-specific mAb was from Bio-Rad (formerly AbD Serotec). The APC-conjugated anti-FoxP3 mAb was purchased from Tonbo Biosciences (San Diego ...
-
bioRxiv - Cancer Biology 2022Quote: ... and β-Actin (Bio-Rad 12004163, 1:10,000) as a loading control ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1:5000 anti-actin-rhodamine (Bio-Rad) as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: ... and hFAB Actin Rhodamine primary antibody (Bio-Rad) for 1 hour at room temperature while protected from light ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Immunology 2022Quote: ... with beta-mercaptoethanol and run using a Mini-PROTEAN Electrophoresis and Transfer system (BioRad). Membranes were incubated with primary antibody overnight at 4°C (ME1 ...
-
bioRxiv - Physiology 2023Quote: ... We normalized the protein bands to beta-tubulin with Image Lab software (Bio-Rad). For citrate synthase activity ...
-
bioRxiv - Cancer Biology 2023Quote: ... and serial dilutions of F-actin or G-actin were blotted on nitrocellulose membrane using Bio-Dot microfiltration apparatus (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and mAb anti-goat IgG were purchased from Bio-rad (Hercules, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total β-Actin (BioRad, USA, 171V60001M) were used for quantification of total proteins ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rhodamine-tagged anti-actin (Bio-Rad #12004163; 1:10,000) was used as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse β-actin-conjugated with DyLight800 (1:10000; Biorad). Alexafluor680-conjugated donkey anti-rabbit and DyLight800-conjugated donkey anti-mouse (both 1:10000 ...
-
bioRxiv - Immunology 2022Quote: TGF-beta isoforms were measured with the Bio-Plex Pro TGF-β assays (Bio-Rad) in accordance with manufactures directions ...
-
bioRxiv - Neuroscience 2022Quote: ... input and precipitated samples were prepared in 5x SDS buffer containing beta-mercaptoethanol (Bio-Rad) and boiled for 5 minutes at 90° C ...
-
bioRxiv - Microbiology 2021Quote: ... serial dilutions of recombinant NS1 Antigen (Ag) (Bio-Rad) was used ...
-
bioRxiv - Cancer Biology 2019Quote: ... FITC-conjugated rat anti-mouse CD68 mAb (clone FA-11, Bio-Rad, Oxford, UK), PE-conjugated rat anti-mouse CD206 mAb (clone MR6F3 ...
-
bioRxiv - Biochemistry 2021Quote: ... The purified mAbs were buffer-exchanged into PBS using a desalting column (Bio-Rad). mAbs were quantified using their theoretical molar extinction coefficients that are calculated based on the contents of aromatic residues and with absorbance at 280 nM measured using a Nanodrop machine.
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal Ab (mAb)-anti-sialoadhesin (Bio-rad, Inc., Hercules, CA, USA; 1:250), goat pAb anti-integrin-α3 (Santa Cruz biotechnology ...