Labshake search
Citations for Bio-Rad :
1 - 50 of 1450 citations for Autophagy Related 4B Cysteine Peptidase ATG4B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... For image (Fig 4B) taken on Chemidoc (BioRad) using the Cy3 blot function.
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cysteine residues were alkylated by incubating with 200 mM iodoacetamide (Bio-Rad) for 1 hr at room temperature in the dark ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... on ice for 24–36 h and then removed through glutathione sepharose 4B beads (5 mL bed volume) packed twice in Poly-Prep® Chromatography Columns (BioRad). UtrCH-sfGFP and LifeAct-sfGFP were further purified through gel filtration column chromatography (HiLoad 16/600 Superdex 75 pg ...
-
bioRxiv - Physiology 2023Quote: ... The incorporated radioactive methionine and cysteine signal was detected using Typhoon Imager (GE) and quantified using Image Lab 6 software (Bio-Rad). Afterwards ...
-
bioRxiv - Physiology 2020Quote: ... versions with an N-terminal cysteine were additionally made in order to conjugate a TMR-C5-maleimide Bodipy dye (Bio-Rad, CA, USA), to make fluorescent TMR-C5-maleimide-SPTISITAPIDVLRKTWAKENMRKQMQINREYLKNLQamide (DH37-F ...
-
bioRxiv - Cell Biology 2021Quote: ... coli antibodies (1:100, Bio-Rad Antibodies, 4329-4906), followed by DyLight 650-conjugated donkey anti-rabbit IgG antibodies (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-Gapdh antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 0.1% Tween-20 in 1x PBS (PBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies were detected using horseradish-peroxidase conjugated anti-rabbit antibodies (BioRad) and detected with Western Lightning ECL reagents.
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... coli antibodies (BioRad, ON) or rabbit anti-Salmonella O antiserum group B antibodies (Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... α-StrepTag antibodies (Biorad). After transferring to nitrocellulose membrane ...
-
bioRxiv - Immunology 2021Quote: ... Virus plaques were visualised by immunostaining with a rabbit polyclonal anti-NSP8 antibody (ABIN233792; Antibodies Online) and an HRP-conjugated anti-rabbit antibody (1706515; Bio-Rad). Plaques were quantified and IC50 values calculated using LabView or SigmaPlot software as previously described (28) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plaques of FCoV were stained with specific antibodies (primary antibody: mouse anti feline coronavirus monoclonal antibody at 1:500 dilution solution, Bio-Rad; secondary antibody ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies were detected using HRP- conjugated secondary antibodies (Bio-Rad, 1:5,000) and ECL (ThermoFisher Pierce) ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody overnight and with secondary antibody (goat anti-mouse IgG-HRP (#1706516, Biorad) for 1h ...
-
bioRxiv - Neuroscience 2020Quote: ... Final panning using antibodies against Thy1.2 (CD90.2) (#MCA02R; Bio-Rad Antibodies, Hercules, CA) positively selected for RGCs ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with a secondary antibody (1:3000 HRP–linked Anti-Rabbit antibody Bio-Rad) and protein bands were visualized with SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermofisher Scientific #34580 ...
-
bioRxiv - Neuroscience 2021Quote: ... For MARCO and TLR2 antibody blockade either 0.8 µg of MARCO antibody (Bio-Rad) 34 ...
-
bioRxiv - Physiology 2021Quote: ... Secondary antibodies goat anti-mouse HRP-linked secondary antibodies (Bio-Rad, Hercules, CA, USA) and goat anti-rabbit HRP-linked secondary antibodies (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antibodies used for SBA: Alexa 488 labeled mouse anti-human CD9 antibody (MCA469A488, Biorad), PE-labeled mouse anti human CD63 antibody (12-0639-42 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The secondary antibody was a goat anti-rabbit antibody conjugated to horseradish peroxidase (BioRad). Bound antibody was visualized by incubation in Clarity ECL substrate (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies include horseradish peroxidase (HRP)-conjugated goat anti-mouse-IgG antibody (BioRad, #1721011) and HRP-conjugated goat anti-rabbit-IgG antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated secondary antibodies (BioRAD) were used at 1:10,000 and blots developed with ChemiGlow detection reagent and visualized using ImageQuant LAS 4000 chemiluminescent camera (GE Healthcare).
-
bioRxiv - Cancer Biology 2021Quote: ... HRP-conjugated secondary antibodies (BioRad) were revealed using the Clarity Western ECL substrate (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... HRP-conjugated secondary antibodies (BioRad) were used at 1:10,000 and blots developed with ChemiGlow detection reagent (ProteinSimple ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-linked antibodies (Bio-Rad, Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... secondary antibody (Biorad #170-6515), H3-HRP (Abcam #ab21054) ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies to TGN46 (AHP500G, Biorad) and GM130 (610822 ...
-
bioRxiv - Systems Biology 2023Quote: ... Horseradish-conjugated secondary antibodies (BioRad) were diluted 1:5000 in blocking buffer and membranes were incubated 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (170-6515, Biorad, 1:3000 in 1x TBS-T with 5 % non-fat dry milk ...
-
bioRxiv - Neuroscience 2023Quote: ... Bound antibodies were detected with the species-appropriate secondary antibodies by a ChemiDoc XRS (Biorad) imager after enhanced chemiluminescence (Supersignal West Pico Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... secondary antibody plates were washed with HBSS and incubated with primary antibody mouse CD11b (BioRad MCA275G) and rat PDGFRa (BD Pharmigen 558774 ...
-
bioRxiv - Immunology 2022Quote: ... the appropriate fluorescent labelled antibodies were used as secondary antibodies with DAPI (Bio-Rad, Watford, England). The sections were incubated for 60 min at room temperature in the dark ...
-
bioRxiv - Genetics 2023Quote: ... the antibodies were detected using goat anti-rabbit IgG StarBright Blue 520 secondary antibodies (Bio-Rad, Hercules ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies for Western blotting included HRP-conjugated goat anti-mouse and -rabbit antibodies (Bio-Rad), or fluorescently labeled donkey anti-mouse and -rabbit antibodies (680RD or 800RD ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were then incubated with the secondary antibody (HRP-conjugated goat anti-mouse secondary antibodies, BioRAD) in B-TBST for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies for Western blotting included HRP-conjugated goat anti-mouse and -rabbit antibodies (Bio-Rad), or fluorescently labeled donkey anti-mouse and -rabbit antibodies (680RD or 800RD ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by secondary antibody (Bio-Rad, Goat-anti-mouse #170-5047 ...
-
bioRxiv - Genomics 2020Quote: ... HRP-conjugated secondary antibodies (Bio-Rad) were used with SuperSignal West Pico ECL (Thermo ...
-
bioRxiv - Immunology 2021Quote: ... Species-specific HRP-conjugated antibody (BioRad) signal was detected using Western Lightning Plus-ECL (Perkin Elmer ...
-
bioRxiv - Bioengineering 2020Quote: ... and FITC-conjugated CD206 antibody (BioRad) to confirm macrophage polarization ...
-
bioRxiv - Biochemistry 2020Quote: ... An HRP-conjugated secondary antibody (BioRad) against either mouse or rabbit IgG was used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... antibodies and ECL (BioRad, USA, 1620177) and analyzed (imaged on ImageQuant600 (Amersham ...