Labshake search
Citations for Bio-Rad :
1 - 50 of 1708 citations for 8H Pyrrolo 2 3 g benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Microbiology 2020Quote: ... M9-G medium was mixed and incubated with 2 g/l Chelex100 (BioRad) for 1 hr at room temperature under constant agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Biophysics 2022Quote: ... The dialysis buffer was additionally supplemented with 2 g BioBeads (BioRad)/l buffer to adsorb detergent monomers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Biophysics 2019Quote: ... Detergent removal was initiated by addition of 0.7 g SM-2 BioBeads (BioRad) in assay buffer (10 mM Hepes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Genetics 2023Quote: ... and orange G) and ran for 3 h at 100 V with a Variable Speed Pump (BioRad) to circulate buffer during the entire gel run.
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Microbiology 2021Quote: ... Detergent was removed by incubation with 0.6 g/ml Bio-Beads SM-2 (Bio-Rad) at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two percent agarose gel was prepared by dissolving 2 g Agarose (Bio-rad, Cat No. 1613102) and 2 µL SYBR Safe DNA Gel Stain (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Biochemistry 2024Quote: ... A hydroxyapatite column was prepared by resuspending 2 g Bio-Gel HTP Hydroxyapatite (Bio-Rad, 130-0420) in 12 ml CDC6 HTP-wash buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2020Quote: ... were added to this for a further 4 h before samples were centrifuged at 10,000 x g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were prepared at 25 µg protein/well with 2X laemmli loading buffer and 2-mercaptoethanol and run on pre-cast 4-15% gels (Biorad). Proteins were wet transferred onto PVDF membranes ...
-
bioRxiv - Microbiology 2019Quote: ... boiled (95°C, 10 min), centrifuged (1,000 × g, 2 min) and loaded on 10% or 4-20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 mg/ml Orange G), denatured (2 min, 80°C) and run on a 10 well 10% TBE-urea gel (Biorad) (200 V ...
-
bioRxiv - Microbiology 2023Quote: ... 10 min), centrifuged (1,000 x g, 2 min) and loaded on 10% or 4–20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Biophysics 2021Quote: ... The mixture was diluted to ~30 mL with sample buffer and stirred at 4°C for 30 min prior removal of C12E8 by adding 4 g of Bio-Beads SM-2 (Bio-Rad) in stages of 0.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were centrifuged for 2 min at 12,000 x g before being separated on 8–16% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad) at 160 V for 60 min ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... The resulting mixtures were dialyzed (20 kDa cutoff) for ∼18h at 4°C in the dark against 250 volumes of FB160M1 containing 2 g BioBeads SM2 (Bio-Rad, Hercules, CA) per 2 mL of RPL mixture ...
-
bioRxiv - Physiology 2023Quote: ... Twenty µg (islet sample) or 2 µg (mouse liver sample: positive control) was mixed with 10uL of Laemmli Sample Buffer (Bio-Rad, Hercules, CA) and denatured at 95°C for 10 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μg of dsDNA were added to the competent cells and then transferred to chilled 2 mm gap electroporation cuvettes (Bio-Rad Laboratories GmbH, Germany). Electroporation transformation was done with a single pulse at 1.8 kV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min in 2 ml screw-cap vials with 2 g of glass beads (2mm) and 200 μl of buffer containing 1 × TE buffer and Chelex®-100 (Bio-Rad Laboratories, CA, USA). Samples were then incubated overnight at 56 °C with 10 μl of Proteinase K (20mg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.