Labshake search
Citations for Bio-Rad :
1 - 50 of 4223 citations for 6 TERT BUTYL 1H PYRAZOLO 3 4 B PYRIDIN 3 AMINE 95% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... 12.5 mM imidazole) for 3 times and boiled at 95°C with 30 μl SDS loading dye (BioRad). After removing the beads ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were boiled at 95 °C for 10 mins with 6×SDS sample buffer before loading onto 4–20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Immunology 2023Quote: ... Protein denaturation before separation was done by treating the cell lysates for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Immunology 2020Quote: ... 6µg of Round or Rod-shaped CCMVTT-VLPs were mixed with 2x mercaptoethanol and heated at 95°C for 3 minutes and then loaded into Any kD Mini-PROTEAN TGX precast protein gels (BIO-RAD). Gel was run for 35min at 180V ...
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Developmental Biology 2019Quote: Oocytes were collected in 0.1% PVP in DPBS and boiled for 3 mins at 95°C in 1x Laemmli Sample Buffer (Bio-Rad, 161-0747) supplemented with β-mercaptoethanol ...
-
bioRxiv - Physiology 2021Quote: ... 95°C for 20 s followed by 40 cycles at 95°C for 3 s and 60°C for 30 s using a real-time thermal cycler (CFX Connect; BioRad, Hercules, CA).
-
bioRxiv - Zoology 2023Quote: ... followed by 40 cycles at 95°C for 3 s and 60°C for 30 s using a real-time thermal cycler (CFX Connect; BioRad, Hercules, CA).
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were denatured at 95 °C for 3 minutes prior to loading onto a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Biorad Cat. No. 4563066). Gels were transferred to a nitrocellulose membrane (Millipore Sigma Cat ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... after 3-4 hrs the beads were passed through Econo-Pac chromatography columns (Bio-Rad) and washed with 20x bead volume of wash buffer in the following order ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled for 3 minutes and separated on a 4-20% precast polyacrylamide gel (Biorad).
-
bioRxiv - Immunology 2023Quote: Fab (3 μg/lane) was loaded on a 4%-12% Bis-Tris precast gel (Bio-rad) in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Molecular Biology 2022Quote: ... lysates from 3×106 cells were separated on 4-20 % gradient Tris-glycine polyacrylamide gels (BioRad 4568094), electroblotted onto a PVDF membrane (Pierce 88518) ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Cancer Biology 2019Quote: ... 20x HEX-labelled CNV TERT reference primer/probe (Bio-Rad), 50ng DNA ...
-
bioRxiv - Immunology 2020Quote: ... amine coupling kit were procured from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Cell Biology 2021Quote: ... boiled at 95°C for 5min and loaded in 4-15% acrylamide gels (Bio-Rad, 5678084). After electrophoresis ...
-
bioRxiv - Bioengineering 2019Quote: ... for 5 min at 95 °C and loaded into a 4– 15% polyacrylamide gel (Bio-Rad). Proteins were transferred to a 0.45 µm PVDF membrane (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5min and loaded in 4-15% acrylamide gels (Bio-Rad, 5678084). After electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sonicated and heated at 95°C for 5 minutes before their separation on a 4-15% gradient SDS PAGE gel (Biorad, 4-15%). Proteins were transferred from gel to nitrocellulose membrane using semi-dry method ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 20X HEX-labelled CNV TERT reference primer/probe (Bio-Rad) for total TERT amplicon count ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...