Labshake search
Citations for Bio-Rad :
1 - 50 of 744 citations for 6 Propoxypyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... amine coupling kit were procured from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... using Bio-Plex Amine Coupling Kit (Bio-Rad, Catalog# 171-406001) according to the manufacturer’s suggestions and diluted to a final concentration of 5×106 beads/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... using the ProteOn Amine Coupling Kit (EDC/NHS coupling chemistry, Bio-Rad) according to the respective manufacturer’s guidelines either on a ProteOn GLC sensor chip or a Series S CM5 sensor chip ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Distinct MagPlex microsphere sets (Luminex Corp) were respectively coupled to viral antigens using the amine coupling kit (Bio-Rad Laboratories) according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Distinct MagPlex microsphere sets (Luminex Corp) were respectively coupled to viral antigens using the amine coupling kit (Bio-Rad Laboratories) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–PAI-1 antibody was coupled to carboxylated polystyrene beads (Luminex) using a Bio-Plex amine coupling kit (Bio-Rad). The coupled beads were then incubated with samples and bound PAI-1/tPA complexes detected using biotinylated rabbit anti-tPA antibody (Molecular Innovations ...
-
bioRxiv - Immunology 2022Quote: Luminex beads used for the serological and purified antibody binding assays were prepared by covalent coupling of SARS-CoV-2 proteins with MagPlex beads using the manufacturer’s protocol with a Bio-Plex Amine Coupling Kit (Bio-Rad, France). Each of the SARS-CoV-2 Spike proteins expressed with different mutations were coupled with different colored MagPlex beads so that tests could be performed with a single protein bead per well or in a multiplexed Luminex binding assay ...
-
bioRxiv - Microbiology 2023Quote: ... Distinct MagPlex microsphere sets (Luminex Corp, Austin, TX, USA) were respectively coupled to viral antigens using the amine coupling kit (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Distinct MagPlex microsphere sets (Luminex Corp) were respectively coupled to viral or control antigens using the amine coupling kit (Bio-Rad Laboratories) according to manufacturers’ instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP) using Micro Bio-Spin 6 columns (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...