Labshake search
Citations for Bio-Rad :
1 - 50 of 5668 citations for 6 METHYL 3 1H TETRAZOL 5 YL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Physiology 2020Quote: ... tissue biopsies were transferred into the assay medium for a 4h incubation (pre-incubation medium supplemented with 4 mg/ml glucose and 4.3% Alamar Blue solution (Bio-rad, Hercules, CA)) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 1h at room temperature with 5% Blotting-Grade Blocker (Bio-Rad, 1706404) in TBS-T buffer ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h-incubation with HRP-conjugated secondary antibodies diluted in 5% milk in TBST (anti-mouse HRP (BioRad, 1706516) 1:10000 ...
-
bioRxiv - Physiology 2021Quote: ... is used for calibration (Figure 1H Biorad #7318223 connected to tubing Picture 1C Tygon #R-3603) ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysates were separated by protein electrophoresis at 150 V for 1h using 4-20% Mini-Protean TGX pre-cast gels (BioRad) and transferred by semi-dry technic onto Amersham Hybond-P PVDF membranes (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP) using Micro Bio-Spin 6 columns (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5 000, Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Immunology 2024Quote: ... the proteins were transferred to a polyvinylidene difluoride membrane (110V, 1h, 4°C) using a Mini Trans-Blot cell apparatus (Bio-Rad). Non-specific binding sites were blocked using PBS/Tween 20 (0.05% Tween 20 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nitrocellulose membranes were blocked for 1h at RT in 5% Blotting Grade Blocker Non-Fat Dry Milk (Biorad, Hercules, CA, USA) and TBST ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Biochemistry 2021Quote: ... pH 5.3 (murine P-domains) or pH 7.3 (GII.4 Saga P-domain) at 4 °C via Micro Bio-Spin 6 columns (Bio-Rad) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons at DIV 4-6 were transfected using a biolistic gene gun (Bio-Rad) and were assayed 3 days after transfection as described previously (5,6,26,27) ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and mixed with a one-third volume of 4×Laemmli protein sample buffer (cat. # 1610747, Bio-Rad). Following centrifugation at 20,000×g at 4℃ for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (30 µg) were run approximately one inch into a 4-15% bis-acrylamide gel (Bio-Rad) and processed for in-gel digestion as previously described (60) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 7.6 with HCl) for one hour and then divided for blotting on the basis of the prestained protein ladder (Bio-Rad, 1610373). Primary antibodies (see antibody table for vendor and dilutions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were then incubated (4°C, overnight) with 5 % milk powder (BioRad) in TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-20μg protein were loaded onto 4-20% SDS-PAGE gels (Biorad) and run at 100V ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).