Labshake search
Citations for Bio-Rad :
1 - 50 of 1721 citations for 6 METHOXY 3 NITROPYRIDINE 2 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 times the critical micelle concentration (CMC) of various detergents (namely LDAO and C8E4) using a Biospin-6 column (BioRad) and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2022Quote: ... were exchanged from size exclusion buffer into 2 M ammonium acetate pH 7.4 via a single-pass through a Bio-Spin P-6 column (Bio-Rad). Buffer-exchanged protein was loaded into gold-coated glass capillaries (1.0 mm OD/0.75 mm inner diameter with filament) ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Biophysics 2021Quote: ... DIV15-30 neurons were transfected 2-6 days before imaging via biolistic gene transfer (160 psi, Helios gene gun, Bio-Rad), as described in a detailed video protocol (Woods and Zito 2008) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were infected with SINV at an MOI of 2 and pictures were taken 6 hours post-infection using ZOE fluorescent cell imager (Bio-Rad). Proteins were collected with lysis buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% (w/v) SDS and 6% (v/v) β-mercaptoethanol) and protein concentrations were quantified using Bradford Protein Assay (Bio-Rad). Equal concentrations of protein were fractionated on NuPAGE 4-12% Bis-Tris Protein Gels ...
-
bioRxiv - Biochemistry 2021Quote: ... was incubated at 55°C for 2 h and then purified by 6% non-denaturing PAGE using a Prep Cell apparatus (Bio-Rad).
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Neuroscience 2024Quote: ... the concentration of the resultant solution containing labelled αSyn was adjusted to 2 mg/mL and excess unbound dye was removed using Bio-Spin 6 size exclusion spin columns (Bio-Rad Laboratories). ATT565-αSyn was added to LUHMES cells on day six in vitro at a final concentration of 2 µM ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...