Labshake search
Citations for Bio-Rad :
1 - 50 of 830 citations for 6 Chloro chroman 3 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Neuroscience 2019Quote: ... N,N,N’,N’-Tetra-methyl ethylenediamine (TEMED, Bio-Rad, 161-0801), 10% ammonium persulfate (APS ...
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was washed with the washing solution twice and then reacted with 4-chloro-1-naphthol (Bio-Rad Laboratories) in the HRP color development buffer (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Cell Biology 2019Quote: ... The bicinchoninic acid assay (Bio-Rad) was used to measure protein concentration from the cell lysates and 20 μg of protein was loaded onto 8% SDS gels and electrophoresed ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Bioengineering 2019Quote: Free FAM NHS ester remaining after purification was quantified by polyacrylamide gel electrophoresis (PAGE) run according to the Laemmli protocol51 (adapted in BioRad Mini-PROTEAN Tetra Cell manual). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP) using Micro Bio-Spin 6 columns (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).