Labshake search
Citations for Bio-Rad :
1 - 50 of 8360 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Quantity One 1-D Analysis Software (Bio-Rad) was used to estimate band intensities of each sample ...
-
bioRxiv - Genetics 2023Quote: ... and Quantity One 1-D analysis software (Bio-Rad). Band density was normalized to the background and statistically analyzed by Student’s t-test in Prism 9 software.
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... Blots densitometric analyses were performed using Quantity One 1-D software (Bio-Rad) and compared with that made by MCID.
-
bioRxiv - Cell Biology 2022Quote: ... Band densitometry analysis was performed using Quantity One 1-D Analysis Software (Bio-Rad). To normalize across different gels and to encompass all 3 ages and genotypes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... A GS-800 calibrated densitometer with Quantity One 1-D Analysis Software 4.6 (Bio-Rad Laboratories) was used for quantitative analysis of protein levels ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Data were quantified using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and analyzed with GraphPad Prism 4 software.
-
bioRxiv - Molecular Biology 2023Quote: ... The intensity of the protein bands was quantified by Quantity One 1-D Analysis Software (Bio-Rad). Background subtraction was performed for each band ...
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of proteins bound to chromatin were quantified using Quantity One 1-D Analysis Software (BioRad) and normalized with their corresponding Histone H2B values ...
-
bioRxiv - Molecular Biology 2023Quote: ... and individual band densities were measured and compared using Quantity One 1-D analysis software (Biorad, USA). The resulting values were normalized separately for each set of time points.
-
bioRxiv - Cancer Biology 2023Quote: ... Blots were visualized using the VersaDoc Imaging System with Quantity One 1-D Analysis software (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... and the band intensities were quantified and analyzed using Quantity One 1-D software (Bio-Rad Laboratories).
-
bioRxiv - Physiology 2020Quote: ... tissue biopsies were transferred into the assay medium for a 4h incubation (pre-incubation medium supplemented with 4 mg/ml glucose and 4.3% Alamar Blue solution (Bio-rad, Hercules, CA)) ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by 3-8% or 8-16% SDS-PAGE (NU-PAGE or BioRad) and transferred to immobilon-P membranes (Millipore) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Screens were analyzed using a Molecular Imager FX and the Quantity One 1-D Analysis Software (Bio-Rad).
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Pathology 2022Quote: ... The expression levels of target proteins were quantified with Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Plant Biology 2024Quote: ... The gels were visualised using a UV trans-illuminator Gel Doc 2000 and Quantity One 1-D analysis v4.6.5 software (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Electrofocusing was performed in glass capillaries with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (#163-1112, #163-1192, Bio-Rad, USA). The second direction is standard SDS 5-10% PAGE followed by staining with Coomassie Brilliant Blue G-250 (#31-4-58-1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were resolved on gradient gels (4-8%; BioRad) and blotted onto nitrocellulose membranes ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Microbiology 2020Quote: ... Visualisation and quantification were carried out using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and data were analyzed with GraphPad Prism 4 software.
-
bioRxiv - Biochemistry 2020Quote: ... 40S and 80S fractions were quantified using Quantity One 1-D Analysis Software v.4.1.2 (Bio-Rad Laboratories, Hercules, CA). Pno1 was quantified using ImageJ Software v1.52 (100 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Digitalized images of the destained SDS-PAGEs were analyzed by the Quantity One 1-D Analysis Software (Bio-Rad, Berkeley, US) to measure the band densities at each lane of all biological replicates ...
-
bioRxiv - Biochemistry 2022Quote: ... before analysis on 8% SDS-PAGE or gradient (4-15%, BioRad) gels and western blotting using anti-FMRP (Cell signaling #LS-C82231 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... antigen retrieval was performed in trypsin (pH 7.8) or 10 mM sodium citrate buffer (pH 6) and then incubated with F4/80 antibody (1:50; MCA497, Bio-Rad) or UCP-1 antibody (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).