Labshake search
Citations for Bio-Rad :
1 - 50 of 1464 citations for 5 SULFOPICOLINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... folic acid 500 μg/L) or on Columbia agar solid support enriched with 5% horse blood (COH) (Biorad). Anoxic conditions were generated in Gaspack (BD ...
-
bioRxiv - Cell Biology 2019Quote: ... The bicinchoninic acid assay (Bio-Rad) was used to measure protein concentration from the cell lysates and 20 μg of protein was loaded onto 8% SDS gels and electrophoresed ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Microbiology 2019Quote: ... An Aminex HPX-87H organic acid analysis column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total protein lysate concentrations were quantified using a bicinchoninic acid (BCA) assay (BioRAD) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... An organic acid column (Aminex HPX-87H 300 × 7.8 mm, Bio-Rad, USA) was employed for the analysis ...
-
bioRxiv - Microbiology 2019Quote: ... Separation was achieved over an Aminex HPX-87H organic acid column (BioRad, USA) under isocratic conditions (0.05 mM H2SO4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein content was determined with a bicinchoninic acid reagent (Bio-Rad, Hercules, CA). Equal loading was verified in a twin run of electrophoresed individual strips of protein stained with Ponceau S (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1x Tris/acetic acid/EDTA (TAE) buffer (Bio-Rad, catalog no. 1610743) at 2.8 V/cm for 6 h 45 min with constant buffer recirculation ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Biochemistry 2020Quote: ... acetylated O-glycans were passed through H+ acid foam (Biorad; Cat. No. 142-1441) and lyophilized ...
-
Efficient breeding of industrial brewing yeast strains using CRISPR/Cas9-aided mating-type switchingbioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the soluble fraction was loaded onto a nickel-nitrotriacetic acid column (Bio-Rad), and proteins were purified according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad, USA) was equilibrated with 5 mM sulphuric acid (H2SO4 ...
-
bioRxiv - Genomics 2023Quote: ... The total protein concentration was determined using the Bicinchoninic Acid (BCA) assay (Bio-Rad). Then ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... The soluble fraction was loaded onto a nickel-nitrilotriacetic acid column (Bio-Rad, Hercules, CA) and proteins were purified following the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: ... organic acids and glycerol were measured using an HPX-87H column (Bio-Rad, CA, USA) at 45°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Acid-treated fiber spreads were incubated with 1/1000 rat anti-BrdU mAb (Bio-Rad) for 1.5 hour to detect CldU ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were measured after sonication by the bicinchoninic acid assay (Bio-Rad, Hercules, CA), and equal amounts of fragmented chromatin–protein complexes were incubated for 2 h with enclosed Dynabeads coupled to rabbit anti-Polβ (Ab26343 ...
-
bioRxiv - Physiology 2019Quote: ... Protein concentration of the supernatant was measured with bicinchoninic acid assay (BCA) kit (Bio-Rad) followed by normalization of proteins via the addition of 1x passive lysis buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Molecular Biology 2019Quote: ... which was blocked with 5% milk (BioRad, Hercules ...
-
bioRxiv - Physiology 2019Quote: ... and an iQTM 5 System (Bio-Rad) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were blocked in 5% milk (BioRad) and incubated with antibodies for BMAL-1 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).