Labshake search
Citations for Bio-Rad :
1 - 50 of 2718 citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were collected and phosphorylated 2-(3H) deoxyglucose was separated by Poly-Prep columns (BioRad). The final eluates were mixed with Ultima Gold Scintillation fluid at a 1:7 Ratio in scintillation tubes and analysed with a beta counter.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Neuroscience 2019Quote: ... N,N,N’,N’-Tetra-methyl ethylenediamine (TEMED, Bio-Rad, 161-0801), 10% ammonium persulfate (APS ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Biochemistry 2023Quote: ... 3H-2DG uptake was subsequently adjusted for protein content using a detergent compatible (DC)-assay (Bio-Rad). The glucose-uptake experiment was repeated on three separate days with same observed effect ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2-5 min and scanned with GS-800 densitometer (Bio-Rad).
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 2 hours in 5% non-fat milk (BioRad) in 1x TBS-T (10 mM tris-HCl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then blocked with 5% skim milk or 3% blotting-grade blocker (BioRad 1706404) for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% (v/v) anhydrous 2-mercaptoethanol (#1610710XTU, Bio-Rad, Hercules, CA, USA). The resulting mixture was then boiled for 15 min and then 35 µl of each sample was loaded into individual wells of 10–20% ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Immunology 2024Quote: ... RNA from 14 3h PBF guts was transcribed into cDNA with the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad) and RT-PCR was performed with RedTaq Polymerase (VWR ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).