Labshake search
Citations for Bio-Rad :
1 - 50 of 1761 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then blocked with 5% skim milk or 3% blotting-grade blocker (BioRad 1706404) for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2019Quote: Organotypic slices were biolistically transfected at 3-5 days in vitro(div) using a Helios GeneGun (Bio-Rad), bullets were prepared using PI4KIIα shRNA alone or in combination with either wild type or S9/51A shRNA resistant PI4KIIα ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...