Labshake search
Citations for Bio-Rad :
1 - 50 of 1860 citations for 5 Cyanopyridin 3 yl methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5% methanol) using a trans-blot system (Bio-Rad). Blocking the PVDF membrane was performed by shaking in TBS-T (10 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Immunology 2021Quote: ... purified recombinant NP samples were loaded to a 15% SDS-PAGE and then transferred to a nitrocellulose membrane of 0.2 μm cutoff using Tris-Methanol buffer (25mM TRIS-HCl, 192 mM glycine, 20% methanol, 0.1% SDS) in a Semi-Dry system (BioRad). The NP-containing membrane was then divided in test strips.
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: ... Gels were transferred to methanol-activated PVDF (BioRad) at 90V for 120 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Immunology 2023Quote: ... and transferred to methanol-activated PVDF membranes (Bio-Rad) by wet transfer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein was transferred to methanol-activated PVDF membranes (Bio-rad) by wet transfer (1x Pierce Transfer Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... methanol (20%) using Semi-Dry transfer apparatus (Bio-Rad, USA). After transfer ...
-
bioRxiv - Neuroscience 2024Quote: ... Gels were then equilibrated in transfer buffer (20% methanol) (BioRad) and total protein was imaged using a ChemiDoc Imaging System (BioRad).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Bioengineering 2022Quote: ... 20% methanol using a TransBlot Turbo Semi-Dry Transfer Unit (BioRad) for 7 min ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Developmental Biology 2022Quote: ... and transferring to methanol-activated PVDF membranes (Bio-rad, cat# 1620177). Specific protein detection was performed using diluted primary antibodies as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were transferred to methanol-activated polyvinylidene difluoride (PVDF) membranes (Bio-Rad) at 100 V for 1,5 h ...
-
bioRxiv - Microbiology 2023Quote: ... and then transferred onto methanol-activated Immun-Blot PVDF membrane (Bio-Rad) using Mini Blot Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 30 min at 100 V in 20 % methanol Towbin buffer (BioRad). Labeled proteins were visualized on the PVDF membrane using a Storage Phosphor screen (Molecular Dynamics ...
-
bioRxiv - Cell Biology 2024Quote: ... After protein transfer onto methanol-activated PVDF membranes (Cat# 1620177, Bio-Rad), membranes were blocked using a 1% gelatin solution for 1 hour at RT ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then blocked with 5% skim milk or 3% blotting-grade blocker (BioRad 1706404) for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were transferred to a methanol-activated PVDF membrane (Bio-Rad,162-0175) for 2 hours at 55 V in a 1X Tris-glycine transfer buffer (25mM Tris base ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto 20% methanol-soaked polyvinylidene difluoride (PVDF) membranes (Bio-Rad, USA). Membranes were blocked in 5% BSA dissolved in Tris-buffered saline containing 0.1% Tween-20 (TBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a methanol-activated Immuno-Blot PVDF Membrane (BioRad, 1620177) using tank-transfer at 300 mA ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 mg ml-1 of methanol-activated Bio-Beads SM2 resin (Bio-Rad) was added and allowed to mix overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Separated proteins were transferred to methanol-activated PVDF membranes using Turboblot transfer (BioRad). Membranes were blocked for 90 minutes in Li-Cor Odyssey Blocking buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to an absolute methanol-activated (10s) PVDF membrane (Bio-Rad 1620177) at 100 V for 1 hr in 4°C pre-chilled 1X Tris-Glycine buffer (Bio-Rad 161-0734) ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were transferred to a methanol-activated PVDF membrane using a TransBlot Turbo (BioRad) via the pre-installed mixed molecular weight setting ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.025% SDS & 10% methanol (vol/vol) in Trans-Blot Turbo Transfer System (Bio-Rad). After incubation with 5% nonfat milk in TBST (50 mM Tris ...
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were transferred to methanol-activated Immuno-Blot PVDF Membrane (Bio-Rad, Hercules, CA). Blots were incubated over-night with primary antibody diluted in PBST (phosphate buffered saline with 1 mL/L Tween-20/PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein was transferred to a methanol-activated polyvinylidene fluoride (PVDF) membrane (Bio-Rad, #1620264) using the iBlot 2 dry transfer system (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... The proteins were transferred onto a methanol-activated Immun-Blot PVDF membrane (Bio-Rad), and the membrane was blocked in 5% Carnation powdered skim milk (Nestle ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a methanol activated (10s) PVDF membrane (Bio-Rad 1620177) at 100V for 1hr in 1X Tris-Glycine buffer (Bio-Rad 161-0734 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PVDF membrane was activated by methanol and then put in Turbo Transfer Buffer (Bio-Rad). Transblot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... and then transferred onto a methanol-activated 0.2 μm polyvinylidene fluoride (PVDF) membrane (Bio-Rad). Membranes were blocked at room temperature for 1 h (5% milk or BSA in TBST pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... then applied to a methanol-pretreated PVDF membrane using a Bio-Dot apparatus (Bio-Rad). The membranes were then probed for TOP2β using standard western blotting procedures.