Labshake search
Citations for Bio-Rad :
1 - 50 of 3662 citations for 3 4 Dehydro Cilostazol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... after 3-4 hrs the beads were passed through Econo-Pac chromatography columns (Bio-Rad) and washed with 20x bead volume of wash buffer in the following order ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled for 3 minutes and separated on a 4-20% precast polyacrylamide gel (Biorad).
-
bioRxiv - Immunology 2023Quote: Fab (3 μg/lane) was loaded on a 4%-12% Bis-Tris precast gel (Bio-rad) in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS ...
-
bioRxiv - Molecular Biology 2022Quote: ... lysates from 3×106 cells were separated on 4-20 % gradient Tris-glycine polyacrylamide gels (BioRad 4568094), electroblotted onto a PVDF membrane (Pierce 88518) ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for DpnII digested DNA or primers 3 and 4 (table S3) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch) with the block settings shown in table 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for DpnII digested DNA or primers 3 and 4 (table S2) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch). PCR amplified samples were purified using the NucleoSpin Gel and PCR cleanup kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...