Labshake search
Citations for Bio-Rad :
1 - 50 of 9714 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: FRET melting competition (FRET-MC) experiments were performed in 96-well plates using a CFX96 qPCR Real-Time PCR (Biorad). The tested sequences (or competitors ...
-
bioRxiv - Genetics 2024Quote: ... FRET measurements were performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Along a melting curve recorded between 55 and 95°C ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2020Quote: ... the plate was inserted into iQ™5 Real-Time PCR Detection Systems (Bio-Rad). The 96 well plate was incubated at 8°C for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: Relative mtDNA content by qPCR with SYBR-based detection (Universal SYBR Green Supermix; Biorad) was conducted as previously described 88 following DNA isolation with the Blood/Tissue DNeasy kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were then subjected to peroxidase-based detection by using enhanced chemiluminescence (ECL) detection reagent (Clarity Max™ Western ECL Substrate, Bio-Rad), and the chemiluminescent signals were visualized by ChemiDoc Touch System (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... based RT-qPCR were run on a CFX384 TouchTM Real-Time PCR Detection System (BioRad), with no-template controls (NTC ...
-
bioRxiv - Plant Biology 2024Quote: ... and chemiluminescence-based signal detection was done with the ChemiDoc Touch Imaging System (Bio-Rad). Antibodies were obtained from commercial suppliers (GFP from Genescript) ...
-
bioRxiv - Evolutionary Biology 2021Quote: The probe-based PCR mastermix included 2xSuperMix (BioRad 186-3023-5) at 1x (10uL per sample) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse primer: 5’-GCAGAAGAAGCAGACACAGC-3’) were PCR amplified and monitored using a CFX96 Touch Real-Time PCR detection system (Bio-Rad). Relative expression of PHETA1 transcripts was normalized to the expression of POLR2A and analyzed using standard delta delta Ct method ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Neuroscience 2019Quote: ... a SYBR based reagent and a CFX384 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Primer sequences (IDT ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed with SYBR-based detection (Universal SYBR Green Supermix; Biorad) using primers for Ppargc1a (5’-ACTATGAATCAAGCCACTACAGAC-3’ and 5’- TTCATCCCTCTTGAGCCTTTCG-3’) ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR Green-based detection was carried out on a real-time PCR instrument (Biorad CFX96 Touch, France) for Il6 (Interleukin-6 ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cell Biology 2021Quote: ... and a colorimetric detection kit (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Genetics 2020Quote: ... Universal SYBR Green Supermix (Bio-Rad)-based qRT-PCR was carried out in a CFX386 Touch™Real-Time PCR Detection System (Bio-Rad). Tspan2 mRNA and Tspan2os RNA expression were calculated by the 2-ΔΔCt method using Hprt as an internal housekeeping control ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the miR200c primers (upstream primer, 5’- TAATACTGCCGGGTAATGATGGA-3’) (Eurofins Genomics) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). U6 primers (TAKARA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reaction products/amplicons were detected based on SYBR green via a CFX96 Real Time PCR Detection System (Bio-Rad). For each time point ...
-
bioRxiv - Developmental Biology 2020Quote: ... SYBR Green based qPCR was performed on a CFX-Connect Real Time PCR Detection System (Bio-Rad, Hercules, CA) using Fast SYBR® Green Master Mix reagent (cat #4385616 ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 5 minutes followed by chemiluminescence detection on ChemiDoc XRS+ (BioRad).
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2024Quote: ... Detection was performed by incubating the membranes with ECL Select Western Blotting Detection Reagent (GERPN2235 – Cytiva) for 3 minutes before detection using a ChemidocMP (Bio-Rad) or Alliance LD2 Imaging System (UviTec Cambridge).
-
bioRxiv - Microbiology 2020Quote: ... were used for detection using the chemiluminescence detection kits Clarity and Clarity ECL (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... SYBR green-based qPCR assays were performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA). The reaction mixture (20 µL ...
-
bioRxiv - Synthetic Biology 2021Quote: The PCIA extracted IP DNA was precipitated and quantified using a homemade EvaGreen based qPCR mix on a CFX Connect Real-Time PCR Detection System (BioRad). qPCR primers are listed in Table S4.
-
bioRxiv - Biochemistry 2024Quote: All fluorescence-based detection assays were carried out in a CFX96 touch real-time PCR system (Bio-Rad, CA, USA). The Cas12a ...
-
bioRxiv - Developmental Biology 2019Quote: ... and an ECL detection kit (Bio-rad Laboratories).
-
bioRxiv - Genetics 2024Quote: ... and an ECL detection kit (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 detection was performed on the CFX96™ Real-Time PCR Detection System (Bio-Rad, California, USA), using the NeoPlex™ COVID-19 Detection Kit (Genematrix ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Touch Real-Time Detection System on 96-well plates (Bio-Rad). The specific primers and probes targeting the conserved region of viral NS gene were designed and available upon request ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... We ran plates on a CFX384 Touch Real-Time PCR detection system (BioRad) under the following thermocycling protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the iQ™5 Real-Time PCR Detection System from BioRad according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... were used for detection using the enhanced chemiluminescence detection kits Clarity and Clarity Max ECL (Biorad).
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were subjected to enhanced chemiluminescence (ECL)-based detection and cytokine signals were visualized using ChemiDoc touch imaging system (BioRad, California).
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...