Labshake search
Citations for Bio-Rad :
3051 - 3100 of 4293 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2E3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... by immunoprecipitation of endogenous or endogenously Flag-tagged Piwi (eF-Piwi): The anti-Piwi antibody and Surebeads Protein A Magnetic bead (Bio-Rad, 1614013) were used to immunoprecipitated endogenous Piwi-piRNAs from witld type OSC ...
-
bioRxiv - Plant Biology 2021Quote: ... The membrane was first probed with the indicated primary antibodies and then incubated with goat anti-rabbit (Bio-Rad, cat. no. 1706515) or goat anti-mouse (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and followed by incubation with HRP-conjugated secondary antibodies for 2 hours at room temperature: goat anti-rabbit IgG (BioRad, #170-6515) or goat antimouse IgG (BioRad ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... blots were washed three times with 1X TBST and probed with the appropriate anti-rabbit (Cat# 170-6515, Bio-Rad, Hercules, CA) or anti-mouse (Cat# 7076 ...
-
bioRxiv - Microbiology 2021Quote: ... Secondary antibodies were matched to the primary antibody and included HRP-conjugated goat anti-rabbit IgG (Bio-Rad Laboratories, Hercules CA, #1706515), goat anti-mouse IgG (Bio-Rad #1706516) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were detected by incubation with HRP-conjugated secondary antibodies for 2 hours at room temperature: goat anti-rabbit IgG (BioRad, #170-6515) or goat anti-mouse IgG (BioRad ...
-
bioRxiv - Immunology 2020Quote: ... RBD-specific antibody titres in oral and nasal swab fluids were determined by ELISA as detailed above except that the conjugated secondary antibody was replaced with either goat anti-porcine IgG HRP (Bio-Rad Antibodies) at 1:20,000 dilution in PBS with 1% (w/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C and the supernatant incubated during 4 h at 4°C with 50 µl of V5 magnetic beads (20 mg/mL of Dynabeads® M-280 Tosylactivated, Invitrogen, coupled with Anti V5-Tag Antibody, clone SV5-Pk1, Bio-Rad). The unbound fraction was discarded and the beads washed 2 times with 1ml of IP Buffer and additionally twice more with 1 ml ice cold PBS + protease inhibitors ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membrane was visualised by chemiluminescence on Biorad ChemiDoc MP Imager after incubation with goat anti rabbit HRP conjugate (Biorad; 170-6515) or goat anti-mouse-HRP conjugate (Biorad ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were stained in different cycles overnight at 4°C with the following antibodies: anti-CD3 (clone CD3-12; #MCA1477, Bio-Rad, USA), anti-CD206 (clone E6T5J ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Additional blood was also collected per experiment and blood (AO) matched to the donor pig using DiaClon Anti-A (Bio-Rad, Germany). Kidneys were perfused via NMP as above before being transferred to new NMP circuits that were primed with the AO matched blood to represent the ‘recipient’.
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2021Quote: ... Digested DNA fragments were then subjected to 1% agarose pulsed-field gel electrophoresis (PFGE) (Bio-Rad) using 0.5% Tris/Borate/EDTA (TBE ...
-
bioRxiv - Biochemistry 2022Quote: ... was added for 1 hour and membranes were imaged using Clarity Western ECL Substrate (Biorad, 1705061).
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... with specific primers as listed in Table 1 and iTaq Universal SYBR Supermix (Bio-Rad, USA). The 10 µL reaction consisted of 5.0 µL 2X Supermix ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.1% Tween 20 (TBST) followed by 1hr incubation with secondary antibody in TBST (1:5000, Biorad). Three washes were given for 10 minutes each after the secondary antibody incubation ...
-
bioRxiv - Bioengineering 2019Quote: ... according to the manufacturer’s manual using a 1% certified megabase agarose (Bio-Rad Laboratories, Cat. # 1613108) gel in 0.5x Tris-borate-EDTA buffer (TBE) ...
-
bioRxiv - Neuroscience 2019Quote: ... three sections of tissue were stained with antibodies against proteolipid protein (MCA839G; Bio-Rad; 1:1000) and imaged at a spatial resolution of 0.28 µm/pixel ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate aliquots with 16 µg protein were denatured in 1× Laemmli sample buffer (Bio-Rad, 1610747) for 5 min at 95°C ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Microbiology 2019Quote: ... The bead/lysate mixture was allowed to pack in a 1 cm separation column (Bio-Rad) and washed with Wash Buffer (50 mM Na2HPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 1 µg RNA by using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2020Quote: ... in 11 parallel transformations (1 mL each) on a Bio-Rad MicroPulser (Bio-Rad, #165-2100). The parallel transformations were combined and mixed with a total of 9.5 mL of recovery medium ...
-
bioRxiv - Biochemistry 2020Quote: ... The absorbance readings were collected at 260nm with a Econo UV Monitor (EM-1 220V, Biorad). After fractionation ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Biochemistry 2021Quote: ... the detergent was removed by adding 0.5 g mL-1 (w/v) Bio-Beads (Bio-Rad) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... The membranes were blocked with 1x Tris buffered saline with 1% casein (Bio-Rad, Cat #: 1610782) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... First-strand cDNA was generated from 1 μg total RNA using the iScript cDNA kit (BioRad) with a poly-T primer as described in the kit’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled samples were diluted 1:1000 and subsequently used as templates for IQ SYBR (Bio-Rad) qPCR reactions ...
-
bioRxiv - Genomics 2022Quote: 1 µg of total RNA was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystem) ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA (1 µg) was reverse-transcribed using the iScript™ Reverse Transcription Supermix (Bio-Rad) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... Electroporation was performed using a cuvette with a width of 1 mm and an electroporator (Biorad) with the settings ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...