Labshake search
Citations for Bio-Rad :
251 - 300 of 4927 citations for Rat Epsin 3 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... adipose tissues were stained with rat anti-F4/80 primary antibody (Bio-Rad, #MCA497B) and goat anti-rat HRP polymer (Cell IDX ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11b (Bio-Rad, #MCA711G, 1:500), and rabbit anti-Iba1 (Wako ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular proteins were detected using the rat monoclonal antibody anti-tubulin (MCA77G, Bio-Rad) diluted 1:3000 in blocking buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11B (1:100; #MCA711G Bio-Rad), rabbit anti-IBA-1 (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... oocytes were exposed to an anti-α-tubulin antibody (rat monoclonal MCA78G, Bio-Rad) overnight at 4°C and Alexa-Fluor-633-labelled goat anti-rat antibody (A-21094 ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Immunology 2021Quote: ... the OD values were read at 450/620 nm by an ELISA plate reader (Bio-Rad, Hercules, CA).
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg RNA was transferred into the cDNA Ecodry Premix Kit prior to the quantitative PCR program being run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, 1725121). Each reaction proceeded at 50 °C for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD206 was detected using rat anti-mouse CD206 (dilution 1/150, Bio-Rad, cat. MCA2235GA) and Alexa Fluor® 546 goat anti-rat antibody (dilution 1/250 ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-rat Ly-6B.2 alloantigen (1:100, MCA771GA, Bio-Rad Laboratories, Hercules, CA) for neutrophils ...
-
bioRxiv - Cancer Biology 2021Quote: ... Acid-treated fiber spreads were incubated with 1/1000 rat anti-BrdU mAb (Bio-Rad) for 1.5 hour to detect CldU ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CD8 (2 µg/rat dissolved in saline solution, clone OX-8, Bio-Rad #MCA48G) or anti-rat TCRαβ antibody (2 µg/rat dissolved in saline solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies used for immunofluorescence include a rat monoclonal anti-Tubulin (BioRad #MCA77G, 1:100 dilution), rabbit polyclonal anti-Senseless (gift from Perry lab ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were utilized: Rat Anti-Myelin Basic Protein (MBP; 1:500, Biorad) and Rabbit Anti-Oligodendrocyte transcription factor 2 (Olig2 ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Immunology 2019Quote: ... and a primary rat anti-mouse CD68 antibody (activated microglia/macrophages, 1:200 dilution, MCA1957, Biorad) with secondary goat anti-rat Alexa-Fluor 555 (1:200 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti–α-tubulin (MCA77G YL1/2, rat monoclonal; Bio-Rad), anti-GAPDH (mouse ...
-
bioRxiv - Cell Biology 2019Quote: Sections of mice peritoneum were stained with primary rat anti-mouse CD68 antibody (MCA1957B, Bio-Rad), rabbit anti-mouse CD38 antibody (bs-0979R ...
-
bioRxiv - Genetics 2019Quote: ... α-tubulin is monoclonal antibody of rat that can recognize alpha subunit (AbD Serotec/BioRad, MCA77G). The second antibodies for staining were Alexa-fluor 488 (Goat ...
-
bioRxiv - Genetics 2021Quote: ... rat anti CD68 (1:200; clone FA-11/MCA1957, Bio-Rad Laboratories Inc, Hercules, CA, USA); rabbit anti LAMP1 (1:200 ...
-
bioRxiv - Genetics 2021Quote: ... tissue sections were stained with F4/80 rat anti mouse antibody clone A3-1 (Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... monoclonal rat anti-F4/80 antibody (dilution 1:200) (clone Cl:A3-1, MCA497G, Biorad Laboratories, Germany) After multiple washes ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:AB_839504) 1:1000 and rat monoclonal CD-68 (Cluster of Differentiation 68; Bio-Rad, MCA1957, RRID:AB_322219) 1:750 overnight at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Gene analysis of TREM2 (PrimePCR™ SYBR® Green Assay: TREM2 for Rat; BioRad, CA, USA) was performed following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... anti-CD31 (rat monoclonal clone ER-MP12, #MCA2388T, RRID: AB_1101899, BioRad Laboratory; 1:200 for IHC), anti-Nestin (chicken polyclonal ...
-
bioRxiv - Physiology 2024Quote: ... exposed to a primary rat anti-mouse F4/80 monoclonal antibody (1/200) (MCA497G, BioRad, USA). A rabbit anti-rat immunoglobulin (1/200 ...
-
bioRxiv - Immunology 2024Quote: ... and stained with rat anti-mouse CD68 primary antibody (clone FA-11; Bio-Rad, Hercules, CA) followed by biotinylated rabbit anti-rat IgG secondary antibody (Vector Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)