Labshake search
Citations for Bio-Rad :
1551 - 1600 of 10000+ citations for Human Serine threonine Protein Kinase 17B STK17B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleaned samples were solubilized in the previous buffer described above and then quantified with the RCDC Protein Assay kit (Biorad, Hercules, CA). Ten μg of protein from each sample were digested in-solution using both Lys-C and Trypsin ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 20 μg of proteins per sample were resolved in 10 or 12% gels (TGX™ FastCast™ Acrylamide kit, Bio-Rad) via electrophoresis ...
-
bioRxiv - Immunology 2020Quote: ... equal protein amounts of the lysates (25 μg) were applied to the Bio-Plex Mouse Cytokine 23-plex Assay Kit (Bio-Rad Laboratories) and measured with the BioPlex200 system and BioPlex-Manager 6.2 according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... the membrane was incubated with peroxidase-conjugated goat anti-mouse IgG and proteins were detected using a chemiluminescence detection kit (Super-Signal West Pico, Pierce) and a ChemiDoc™ MP system (Bio-Rad).
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Genetics 2023Quote: ... and luciferase activities were normalized to total protein levels in the WCEs extracts determined using the Bradford assay kit (Bio-Rad Laboratories).
-
bioRxiv - Biochemistry 2023Quote: ... The determination of casein concentration by the Lowry method was performed using the DC™ protein assay kit purchased from Bio-Rad Laboratories (California ...
-
bioRxiv - Neuroscience 2023Quote: ... Once ready for testing we quantified the amount of mitochondria from each isolation using Bio-Rad Protein Assay Kit (Bio-Rad, #5000001), plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatants were collected and protein concentration was calculated by Bradford Protein Assay (Bio-rad). The denatured lysates were electrophoresed on SDS-PAGE gels and transferred to polyvinylidene fluoride membranes (BioExpress) ...
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration in the supernatant was determined using DC protein assays (Bio-rad, 5000116) with bovine serum albumin solutions as standards ...
-
bioRxiv - Physiology 2022Quote: ... Samples were loaded alongside 10 µL protein ladder (Precision Plus Protein Standards Kaleidoscope ladder, BioRad). Self-cast gels (Mini-PROTEAN ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration in each fraction of soluble proteins was determined by Bradford assay (Bio-Rad). Specific ß-galactosidase activities in the same fractions were measured according to Miller (51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration of the clarified lysate was measured using DC™ Protein Assay (Bio-Rad). Protein levels of wild-type or mutant Rad6 were determined by immunoblotting using anti-Flag M2 antibody (Sigma).
-
bioRxiv - Cancer Biology 2019Quote: ... Total protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). Nuclear extracts containing the total of 40 µg protein were separated on a 10% Tris-SDS PAGE gel (Bio-Rad Mini-PROTEAN® TGX) ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein concentrations of the supernatants were determined with Bradford protein assay (Bio-rad, Hercules, CA). Supernatants were mixed with 4x β-mercaptoethanol Laemmli sample buffer to a final 25 μg protein/sample ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad).
-
bioRxiv - Neuroscience 2019Quote: ... The protein concentration was measured using the BCA protein assay according to manufacturer’s instruction (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protein concentration was measured using the Bradford protein assay following the manufacturer’s instructions (Bio-Rad). The samples were mixed with 6X loading buffer (240 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total protein concentration was determined by DC™ Protein Assay (Bio-Rad, Hercules, CA, USA). All the samples were kept at −70°C until they were used for analysis.
-
bioRxiv - Genetics 2021Quote: ... The protein content of the lysate was determined using Bio-Rad Protein Assay (Bio-Rad) on a spectrophotometer ...
-
bioRxiv - Plant Biology 2020Quote: ... The protein concentration in samples was determined using the DC Protein Assay (BioRad, CA, USA). Protein samples (10 μg per lane ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein content of the samples was determined with the RC DC protein assay from BioRad. For the first dimension ...
-
bioRxiv - Neuroscience 2020Quote: ... Total protein concentration was determined by BCA protein assay (Bio-Rad Laboratories, Hercules,CA, USA), cell lysate samples were aliquoted and stored at −80°C till used ...
-
bioRxiv - Plant Biology 2021Quote: ... and total protein concentration was estimated using Quick Start Bradford Protein Assay (Bio-Rad Laboratories). Protein samples were subjected to in-solution tryptic digestion followed by mass spectrometry (MS ...