Labshake search
Citations for Bio-Rad :
451 - 500 of 4896 citations for 6 fluoro 2 hydroxyquinoline 4 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... and 2% Bis-Acrylamide (Bio-Rad) with milliQ water as described elsewhere 38 ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µL propidium iodide (BioRad, 1351101) was added to the single-cell suspension and sorting was performed on the PI-negative live cell population using fluorescent-activated cell sorting (FACS) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 2-mercaptoethanol (BIO-RAD, 1610710) was added to the samples which were heated (95°C ...
-
bioRxiv - Biophysics 2023Quote: ... and bis-acrylamide (2% solution, BioRad) were polymerized by addition of 0.1%(v/v ...
-
bioRxiv - Immunology 2023Quote: ... Kallestad HEp-2 slides (BIO-RAD) were stained overnight with 1µL of serum from either Lyn-/-IgD+/- or wildtype mice ...
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were activated with methanol ...
-
bioRxiv - Cell Biology 2023Quote: ... 66 µl 2% bisacrylamide (Bio-Rad), 334 µl water for a final concentration of 12.5% acrylamide and 3.75% bisacrylamide in water ...
-
bioRxiv - Bioengineering 2024Quote: ... 2% Bis-Acrylamide solution (BIORAD, #1610142), and distilled water was blended and adjusted to manufacture PA gels with varying rigidity ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were added to the mixture ...
-
bioRxiv - Immunology 2020Quote: ... EVs or S-Trim preparations were separated by SDS-PAGE on a 4−15% acrylamide gel (4−15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently transferred onto PVDF membrane ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were analyzed by SDS-PAGE (either 4-20% Tris-glycine or 4-12% Bis-tris pre-cast gel, Bio-rad Laboratories, Inc.) and transferred to nitrocellulose membranes (Bio-rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by SDS-PAGE on a 4-15% acrylamide gel (4–15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently immobilized by electro-transfer to PVDF membrane.
-
bioRxiv - Cell Biology 2019Quote: ... Non-denaturated proteins were separated by native-PAGE on a 4-15% acrylamide gel (4–15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) using 25 mM imidazole pH 8.0 as anode buffer and 50 mM Tricine ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lysates were heated for 15 minutes at 50 °C before being loaded onto 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Microbiology 2020Quote: Extracellular concentrations of organic acids (acetate, lactate, formate) and ethanol (from 2.4.3) were determined by HPLC (BioRad HPX-87H 300*7.8 mm column ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentration was estimated on the lysates using a bicinchoninic acid protein assay Kit (5000111, Bio-Rad). Equal protein concentrations for each of the samples were incubated with Myc antibodies overnight ...
-
bioRxiv - Microbiology 2023Quote: ... destained in 7.5% acetic acid for 1 minute and imaged using a ChemiDoc imaging system (Bio-Rad). For western blotting ...
-
bioRxiv - Microbiology 2022Quote: ... Resulting lipopolysaccharides were separated using gradient 4–20% sodium dodecyl sulfate□polyacrylamide gel (4–20% Mini□PROTEAN® TGX™ Precast Protein Gel, BioRad, Hercules, USA) electrophoresis (SDS□PAGE ...
-
bioRxiv - Neuroscience 2023Quote: 15-20 µg of protein were loaded onto 4-12% Bis-Tris gels (Novex, Cat. no: NP0336BOX) or 4-20% Tris-Glycine extended gels (BIO-RAD, Cat. no: 4561095) for separation and transferred to nitrocellulose or methanol activated PVDF membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on 4-20% gradient gels (BioRad 4561096).
-
bioRxiv - Biophysics 2021Quote: ... Purity was confirmed by SDS-PAGE (4 – 20% TGX, BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were loaded to 4-15% polyacrylamide gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Cancer Biology 2021Quote: ... and separated on 4-15% Protein Gels (BioRad, Cat# 4568084). SPOP protein was probed by using in-house made rabbit anti-SPOP (1:1000) ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples underwent electrophoresis on 4-15% gradient polyacrylamide gels (BioRad) and were immunoblotted with Rabbit anti-ADAM17 (CST ...