Labshake search
Citations for GeneCopoeia :
1 - 43 of 43 citations for Recombinant HIV 1 gp120 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: His-tagged SSRP1 was PCR amplified from SSRP1 pReceiver (GeneCopoeia) using primers encoding an N-terminal His tag and NdeI/NotI cut sites for cloning into pET22b ...
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Cell Biology 2022Quote: ... an HIV based lentiviral third generation system from GeneCopoeia was used to generate pseudolentiviral particles ...
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral GFP-tagged ERF (GeneCopoeia, EX-S0501-Lv122) was used to develop DU-145 ERF cells with puromycin (1μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral GFP-tagged ERF (GeneCopoeia, EX-S0501-Lv122) were used to develop PC-3 shERFA1 and PC-3 ERF OE respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... Flag-PFDN2 and Flag-VIM) and the bacterial expression vectors pReceiver-B11 (His-NSMCE2 and His-PFDN2) were purchased from Genecopoeia, Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral GFP-tagged ERF was obtained from GeneCopoeia (EX-S0501-Lv122). pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Genomics 2021Quote: Lentivirus was produced in twelve 15cm dishes of 293T cells using Lenti-Pac HIV expression packaging kit following the manufacture’s protocol (GeneCopoeia, LT002). Lentivirus was filtered through a 0.45um PES filter system (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... were infected with lentiviral particles produced by transfecting 293T cells using the lentiviral expression vectors and the Lenti-PacTM HIV Expression Packaging system from Genecopoeia. The PDAC cells were selected with puromycin (4 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... were infected with lentiviral particles produced by transfecting 293T cells with the lentiviral expression vectors and the Lenti-PacTM HIV Expression Packaging system from Genecopoeia. Stable clones of the PDAC cells were obtained by selection with 4 μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Neuroscience 2020Quote: ... or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS). The stably transfected cell lines were selectively maintained in media containing DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were transfected with 10 μg of Flag-tagged HsFN3K (EX-W1392-M46, GeneCopoeia) using Calcium Phosphate Transfection protocol (43) ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the SUV420H2 sequence was amplified from an ORF expression clone for SUV420H2 (eGFP tagged) (EX-V0810-M98, GeneCopoeia) introducing a stop codon ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG and FLAG-tagged PCNA expressing lentiviral plasmids were purchased from GeneCopoeia (EX-NEG-Lv203 and EX-B0066-Lv203). The lentiviral constructs harboring siRNA-resistant pHAGE-HLTF-WT and R71E Hiran mutant were (Taglialatela et al. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Cell Biology 2022Quote: Stable cell lines expressing FLAG-tagged SLC25A1 were prepared by transfecting human neuroblastoma SH-SY5Y cells (ATCC, CRL-2266; RRID:CVCL_0019) with ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS) (Gokhale et al. ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Neuroscience 2020Quote: ... or with LV encoding for synapsin 1 (Syn1) fused to GFP (GeneCopoeia, Inc., cat.# LPP-Z5062-Lv103-100), for live-cell imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral particles for MART-1 expressed from an EF1a promoter with an IRES-eGFP were purchased from Genecopoeia (G0616-Lv225). GFP control was expressed using a lentiviral vector with an EF1a promoter and IRES-eGFP.
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... pGEX-GST-6P-1-GST-PHC3 was generated similarly with PCR amplification of PHC3 using pEZ-M39-PHC3-FLAG (EX-L3818-M39, Genecopoeia) and ligation into pGEX-GST-PHC2-Cerulean FLAG after digestion to remove PHC2 ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...