Labshake search
Citations for GeneCopoeia :
1 - 50 of 120 citations for Human TENC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA plasmids were procured from Genecopoeia (Rockville, MD, USA), and overexpression plasmids were obtained from AddGene (Watertown ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding LAR shRNA and scrambled controls were purchased from GeneCopoeia. Packaging (pCMVR8.74 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA sequences are as follows: GGTGGAGATGATCTTAAACAA (HSH005861-LVRU6GP, for Human AKR1B1, GeneCopoeia), CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01 ...
-
bioRxiv - Developmental Biology 2023Quote: A shRNA plasmid clone set targeting Dlc1 was obtained from GeneCopoeia (MSH100727-LVRU6MP). Each set contains 3 shRNA expression constructs and 1 scrambled shRNA control ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA were from Genecopoeia, hygromycin selection ...
-
bioRxiv - Cancer Biology 2020Quote: ... The DPF1 shRNA and the corresponding Scrambled shRNA control were purchased from Genecopoeia. The vector was psi-LVRU6GP and the target sequences were ...
-
bioRxiv - Cell Biology 2022Quote: ... MAFA shRNA (Genecopoeia, Rockville, MD), and MAFB shRNA (VectorBuilder ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Neuroscience 2020Quote: ... WDR81 shRNA was provided by Genecopoeia™ ...
-
bioRxiv - Cell Biology 2024Quote: The pReceiver-Lv165 human BMI1 overexpression plasmid (EX-B0015-Lv165, GeneCopoeia) and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165 ...
-
bioRxiv - Microbiology 2021Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China). Anti-RBD monoclonal antibodies (mAbs ...
-
bioRxiv - Microbiology 2020Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Microbiology 2021Quote: ... Human ACE2 and DPP4 expression plasmids were derived from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Biochemistry 2019Quote: Two unique OmicsLink™ shRNA expression vectors (Genecopoeia) were used to target the coding sequence of human DDX28 [HSH014712-3-nU6 sequence 5’-ggtggactacatcttagag-3’ ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... Pcx-targeting shRNA were purchased from Genecopoeia (Rockville, MD) in a psi-LVRU6H vector ...
-
bioRxiv - Neuroscience 2019Quote: ... shRNA against rat Tpm3.1 (NM_173111.1) was purchased from GeneCopoeia (RSH053175-33-mH1 ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Lentivirus-shRNA p62/Sqstm1 (Product ID: MSH093992, Accession: NM_011018.3, GeneCopoeia) were used to express miR-27a and knockdown p62 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10 μg of the following anti-FOXM1 shRNA from Genecopoeia: sh-C (5’-TAATACGACTCACTATAGGG-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... human GSAP-16k with HA tag (a.a. 733 to a.a. 854 subcloned from full length human GSAP plasmids, EX-Z2830-M07, Genecopoeia), human Arcn1 with Myc and Flag tags (RC210778 ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a EGFP overexpression plasmid as control plasmid (#EX-EGFP-Lv151, Genecopoeia). Cell lines were transduced at high MOI as previously described68 with overnight virus incubation.
-
bioRxiv - Molecular Biology 2023Quote: ... and human Sprr1a (GeneCopoeia, HQP060361) were employed to detect expression of Sprr1a ...
-
bioRxiv - Neuroscience 2022Quote: ... 5μg of FLAG-Prrt2 plasmid (GeneCopoeia) and 5μg of SNARE plasmid (T7- VAMP2 or myc-STX1A ...
-
bioRxiv - Immunology 2023Quote: ... Ndufa4l2 plasmid (EX-J0135-M02, GeneCopoeia) or Empty control vector (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2021Quote: Human PPARGC1A cDNA was obtained from GeneCopoeia. Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2019Quote: ... the packaging plasmid (psPAX2) and the envelope plasmid (pMD2.G) were amplified in E.coli (GCI-L3; GeneCopoeia), and purified with a silica column (Qiagen Maxiprep) ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for Rab7A (plasmid number HTN218819, Genecopoeia, Rockville, MD). 72 hrs post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... One plasmid on the pCRISPR-CG01 backbone (GeneCopoeia) codes for recombinant Cas9 and a sgRNA (5’-GCCAAACATAAGTGACCAAC-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: Plasmids used in this study were purchased from GeneCopoeia or OriGene ...
-
bioRxiv - Developmental Biology 2021Quote: ... pReceiverM04-GST-CTBP2 and pReceiverM04-GST-GFP plasmids (GeneCopoeia) 24 hours later ...
-
bioRxiv - Microbiology 2020Quote: ... The second plasmid on the pDONOR-D01 backbone (GeneCopoeia) has a mCherry-T2A-Puro reporter cassette flanked by homology regions adjacent to the sgRNA target site in the genome ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FGFR1-3’UTR target plasmid (HmiT005432-MT06; GeneCopoeia) was co-transfected with 50 nM NCm or miR-22m into 293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... Other plasmids used include pReceiver M14 PINK1-3xFLAG (Genecopoeia), denoted as PINK1-3xFLAG ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... custom COL2A1-Gaussia Luciferase plasmid (HPRM22364-LvPG02, GeneCopoeia, Inc.), envelope (pMD2.G ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Lipofectamine 2000 has been used to transfect MIN6 cells with CRTC1 overexpressing plasmid (EX-Mm18750-Lv183) or with control plasmid (EX-EGFP-Lv151) (both from Genecopoeia, Rockville, MD, USA). Lipotoxic stress has been induced by using 0.5 mM of sodium palmitate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... pCas-guide plasmids were co-transfected with pDonor-D09 (GeneCopoeia), which carries a Puromycin resistance cassette ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids N-flag-HAT1wt (GeneCopoeia, Cat# EX-I0105-M13-11) and pCMVβ-p300-myc (Addgene ...