Labshake search
Citations for The Jackson Laboratory :
1 - 50 of 65 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped with primer sets suggested by Jackson labs.
-
bioRxiv - Neuroscience 2021Quote: ... miR-17∼92fl/fl mice (miR-17∼92fl/fl, The Jackson Laboratory, JAX ...
-
bioRxiv - Immunology 2022Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for CD4cre ...
-
bioRxiv - Immunology 2021Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for Eomes ...
-
bioRxiv - Neuroscience 2023Quote: ... The recommended primers and PCR protocols designed by Jackson laboratories were used to verify the transgenes (primers purchased from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: 64 adult C57BL/6J mice (32 female, 32 male) were ordered from Jackson laboratories. Mice arrived at the School of Science Vivarium at Indiana University-Purdue University Indianapolis (IUPUI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers and PCRs were done as specified by protocols by Jackson Laboratory. Identification of intact Tet2 (Protocol 19042 ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (n=32) and female (n=32) C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) at least 8 weeks in age were used in all experiments and singly housed ...
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Immunology 2020Quote: ... Trp53+/- mice [32] were imported from Jackson Laboratories. Paxx+/- [16] and Mri+/- [18] mice were generated by the Oksenych group and described previously.
-
bioRxiv - Physiology 2020Quote: ... floxed miR-150 mice (STOCK Mir150tm1Mtm/Mmjax mice from Jackson Laboratories) C57/Bl6 background were crossed with C57/Bl6 mice carrying tamoxifen-inducible Cre recombinase under the control of the Cdh5 promoter (Cdh5(PAC)-iCreERT2 (Wang ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were performed on 32 adult (12–32 weeks old, 20–30 g, 21 male and 11 female) C57BL/6 mice (Jackson Laboratories). Mice were housed under a reverse 12:12 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tifab−/-;miR-146a−/- mice were crossed with Trp53−/- mice (Jackson Laboratories, 002101). All mice were bred ...
-
bioRxiv - Immunology 2021Quote: ... Sle1b mice [detailed previously (41)] were crossed to miR-21KO mice (Jackson Laboratory stock #016856) to generate Sle1b.miR-21KO ...
-
bioRxiv - Neuroscience 2023Quote: ... These studies used C57BL/6J mice obtained from Jackson Labs (N=32). Only males were used since female reproductive cycles affect seizure frequency (Joshi et al. ...
-
bioRxiv - Physiology 2023Quote: ... Genotyping was performed in-house by PCR from tail snip DNA samples using guidelines and primer sequences from Jackson Laboratory, or was performed by Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped to verify igfrf/f homozygosity and igfap-Cre/ERT or icamk2a-cre/ERT2 expression using the primers and suggested PCR protocols designed by Jackson laboratories, as previously reported (Prabhu ...
-
bioRxiv - Neuroscience 2023Quote: ... 21 mouse lines were used for experiments in this study and genotyping was performed using primers and polymerase chain reaction (PCR) conditions listed on the vendor website (Jackson labs). All animals were maintained on the C57BL6/L background ...
-
bioRxiv - Neuroscience 2023Quote: ... The Jackson Laboratory)32 were crossed with Ai14 tdTomato reporter mice (Strain 007908, The Jackson Laboratory)33 ...
-
bioRxiv - Physiology 2019Quote: ... The DNA purified from the tails was used in PCR reactions for genotyping of mice in the SLAMF6 locus on chromosome 1 (primers adapted from the Jackson laboratories website) and in the Pmel-1 locus on chromosome 2 (Ji et al. ...
-
Dopaminoceptive D1 and D2 neurons in ventral hippocampus arbitrate approach and avoidance in anxietybioRxiv - Neuroscience 2023Quote: Male C57BL/6J mice (8-32 weeks old, 20-30 g, The Jackson Laboratory) were maintained on a 12:12 h light/dark cycle (07:00 lights on ...
-
bioRxiv - Bioengineering 2020Quote: ... 32-36 wks) and age-matched FVB/NJ healthy controls (Jackson Labs; 28-36 wks) were anesthetized using isoflurane inhalation (Zoetis) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: C57BL/6J mice (20–32 g each) were obtained from Jackson Laboratories (Bar Harbor, ME). MOR KO ...
-
bioRxiv - Neuroscience 2024Quote: PV-Cre female mice were bred with Ai-32 (ChR2(H134R)-EYFP) males (Jackson Labs), to produce offspring PV-Cre:Ai-32 mice expressing ChR2 in parvalbumin-positive (PV+ ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Neuroscience 2024Quote: ... Female C57BL/6J mice were purchased at ∼10 and ∼32 weeks of age from Jackson Laboratories (Bar Harbor, ME, USA). Following one week of acclimation ...
-
bioRxiv - Cell Biology 2021Quote: mgWAT from RT or cold exposed mice (Jackson Laboratory, #000664) was fixed in 10% formalin overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... and age-matched (25–32 g) homozygous Tg(TIE2GFP)287Sato/J transgenic reporter mice (Tie2-GFP mice, #003658, The Jackson Laboratory) expressing GFP under the endothelial-specific receptor tyrosine kinase (Tie2 ...
-
bioRxiv - Neuroscience 2021Quote: ... All experiments were performed using 8 male and 6 female adult (12– 32 weeks old, 20–30 g) C57BL/6 mice (Jackson Laboratories). Mice were housed under a reverse 12:12 h ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: Male C57BL/6J mice (n = 131; 25–32 g; 10–13 weeks old at the time of surgery) purchased from Jackson Laboratories were used for behavioral tests ...
-
bioRxiv - Neuroscience 2020Quote: ... Among 32 transgenic mice expressing the Cre-recombinase under the control of the Parvalbumin promoter (PV-Cre, Jackson Laboratory, B6;129P2-Pvalbtm1(cre)Arbr/J) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was performed at weaning using primer sequences published by Jackson laboratories. Male and female mice were used in all experiments ...
-
bioRxiv - Immunology 2022Quote: ... were bred in house from breeders set up with C57BL6 mice purchased from Jackson Laboratory (Harbor, ME). Beddings of the cages harboring young and aged mice were exchanged once per week for at least 4 consecutive weeks to ensure the homogenization of microbiota ...
-
bioRxiv - Cell Biology 2022Quote: ... All mice were genotyped for Nox4 using primer sequences provided by Jackson Laboratory, and for Ltbp4 and mdx alleles using published genotyping primers (16).
-
bioRxiv - Neuroscience 2022Quote: ... Mice tail samples were genotyped using the following primers suggested by Jackson Laboratories: Piezo1-28247-forward ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping for Cas9 transgene was performed with primer sequences provided by Jackson laboratories. All experiments were performed with approval of a local ethics committee (Bezirksamt Arnsberg ...
-
bioRxiv - Neuroscience 2023Quote: ... stock number: 008683) and primer sequences for genotyping were provided by Jackson laboratories. This breeding setup allowed us to use experimental cohorts that contained litter- and sex-matched mice randomly assigned to experimental groups ...
-
bioRxiv - Neuroscience 2020Quote: ... we set up timed matings of wild-type C57BL/6J mice (000664, The Jackson Laboratory, Bar Harbor, ME). At embryonic day (E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Breeding was set up between Chchd10S55Lheterozygous (Het) males with wildtype (WT) C57BL/6NJ females (Jackson Laboratory, stock #005304). Tail DNA was extracted with a Promega kit and genotype was determined by sequencing services at Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
bioRxiv - Cell Biology 2021Quote: Mammary gland white adipose tissue (mgWAT) from RT or cold exposed mice (Jackson Laboratory, #000664) was dissected ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping of the Y1-lox/lox was performed using primers and conditions provided by Jackson Labs. All other strains were genotyped by Transnetyx ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue sections were blocked for 2 hours at RT with 10% Donkey Serum (Jackson Laboratories, ME), 5% BSA (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS and incubated for 1h at RT with secondary antibody (Jackson Laboratories) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... with additional internal control primers CTA GGC CAC AGA ATT GAA AGA TCT (oIMR7338; The Jackson Laboratory) and GTA GGT GGA AAT TCT AGC ATC ATC C (oIMR7339 ...
-
bioRxiv - Immunology 2021Quote: ... Tail DNA screening was performed using polymerase chain reaction for cre using primer sequences recommended by Jackson Laboratory (Forward ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked for two hours at RT with Donkey anti-mouse IgG (Jackson Labs Catalog No.715-007-003); washed 3 times with TBS-T (.05% Tween ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 1h at RT with secondary antibodies used at 1:250 dilution: anti-rat 405 (Jackson Lab), anti-rabbit 594 (Jackson Lab) ...