Labshake search
Citations for The Jackson Laboratory :
2801 - 2850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Wild-type male C57BL/6 mice were received from Jackson Labs (Bar Harbor, ME) at approximately 8–10 weeks of age and acclimated to the animal holding facility for 1–2 weeks ...
-
bioRxiv - Immunology 2023Quote: ... Ten HIS-NSG mice (NSG™ NOD.Cg-Prkdcscid Il2rgtm1Wjl, Stock No. 005557) engrafted with CD34+ cells from 2 donors (The Jackson Laboratory, Bar Harbor, ME) were treated intravenously once with 1 mg/kg of MDK-703 or a human Fc control ...
-
bioRxiv - Neuroscience 2023Quote: ... CAG-Sun1/sfGFP mice (Jackson Laboratory #021039), and NDNF-ires-Cre mice (Jackson Laboratory #030757) ...
-
bioRxiv - Cancer Biology 2023Quote: ... B6.129S Tnfrsf1atm1ImxTnfrsf1btm1Imx (denoted as Tnfr1-ko, originally from Jackson lab #003243) were acquired through the Swiss Immunology Mouse Repository (SwImMR) ...
-
bioRxiv - Bioengineering 2023Quote: ... Six-to-eight weeks old male NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice were purchased from Jackson Laboratory or UCSD Animal Care Program.
-
bioRxiv - Cell Biology 2023Quote: ... Piezofl/fl (Jackson Labs, 027720), Vilin-cre (Jackson labs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rag1-/-(RRID:IMSR_JAX:002216) mice were purchased from Jackson Laboratory and bred in house ...
-
bioRxiv - Neuroscience 2023Quote: ... Founder mouse strains were obtained from Jackson Laboratories and backcrossed to C57Bl6/J (#000664 ...
-
bioRxiv - Immunology 2023Quote: ... 6-8-week-old BALB/C mice were purchased from Jackson lab, which were used for Colon26 mouse model ...
-
bioRxiv - Physiology 2023Quote: ... all mice were homozygous for the dual-fluorescence Cre-reporter allele ROSAmT/mG (Jackson Laboratory; strain #: 007576); thus ...
-
bioRxiv - Physiology 2023Quote: Mice carrying Cre-recombinase driven by the Ucp1 promoter (i.e. Ucp1-Cre) were purchased from Jackson Laboratories (Stock No: 024670; B6.FVB-Tg(Ucp1-cre)1Evdr/J) ...
-
bioRxiv - Immunology 2023Quote: ... B6.PL-Thy1a/CyJ (CD90.1, Strain:000406), C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J (Nur77-GFP, Strain:016617) mice were purchased from Jackson Laboratory and bred in specific pathogen-free conditions at Oregon Health and Sciences University or New York University Grossman School of Medicine ...
-
bioRxiv - Immunology 2023Quote: C57BL/6J mice (Jackson Laboratory, Bell Harbor, ME) were infected with either 30 μl of 500 TCID50 mouse-adapted PR8-HA-GP61-80 or 2×105 PFU of LCMV Armstrong by intranasal inoculation or immunized by intramuscular (quadriceps ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary Horseradish Peroxidase (HRP)-coupled antibodies were from Jackson Laboratories.
-
bioRxiv - Bioengineering 2023Quote: ... All animals were purchased from Jackson Laboratories (Bar Harbor, ME), and maintained in UT Southwestern Medical Center animal facilities by following guidelines according to UT Southwestern Medical Center Institutional Animal Care and Use Committee (2017-102240) ...
-
bioRxiv - Neuroscience 2023Quote: Twelve-month-old C57Bl/6 mice (Jackson laboratories) on standard light-dark cycles with ad libitum food and water were transferred to Animal BioSafety Level 3 facilities and micro-isolation cages (3-5 mice/cage ...
-
bioRxiv - Genomics 2023Quote: ... Animals were of C57BL/6J background (Jackson Laboratory, Bar Harbor, ME, USA). The strategy for the generation of Mpo -/- mice has been described previously (Brennan et al ...
-
bioRxiv - Immunology 2023Quote: ... and K18-hACE2 mice purchased from Jackson Laboratory (8 hACE2 copies) were snap-frozen on dry ice ...
-
bioRxiv - Genomics 2023Quote: Male 14-16-week-old C57Bl/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). The animal study protocol was approved by the Administrative Panel on Laboratory Animal Care at Stanford University and procedures were followed in accordance with institutional guidelines.
-
bioRxiv - Immunology 2023Quote: ... FoxP3-IRES-GFP transgenic mice (B6.Cg-Foxp3tm2Tch/J, Strain #:006772 from Jackson Laboratory) were a gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... Sykflox/flox LysM Cre+ and Sykflox/flox LysM Cre- littermates were generated by crossing LysM Cre+ mice to Sykflox/+ mice (all on a C57BL/6J background, which along with WT C57BL/6J mice, had been purchased from Jackson Labs (Bar Harbor, ME)) ...
-
bioRxiv - Physiology 2023Quote: ... HSA–Cre (stock #006149) transgenic mice were obtained from Jackson Laboratory (Bar Harbor, ME). Homozygous floxed Pank4 mice were then crossed with HSA–Cre mice to obtain muscle-specific Pank4 KO (Pank4flox/flox:HSA-Cre-/+ ...
-
bioRxiv - Systems Biology 2023Quote: ... and geriatric (26 mo) C57BL/6J mice (Jackson Laboratory # 000664; NIA Aged Rodent Colonies) by injecting both tibialis anterior (TA ...
-
bioRxiv - Microbiology 2023Quote: ... Male 7-week-old C57BL/6 mice obtained from Jackson Laboratory were used for all experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Prox1-CreERT2 30 and Ai14 reporter31 (Stock No. 007914; Jackson Laboratory) mice were crossed to generate tamoxifen inducible ...
-
bioRxiv - Neuroscience 2023Quote: ... Agrptm1(cre)Lowl/J (AgRP-IRES-Cre148, 012899, The Jackson Laboratory), Mc4rtm3.1(cre)Lowl/J (MC4R-2A-Cre44 ...
-
bioRxiv - Neuroscience 2023Quote: ... loxp-mG5 (see32, kindly provided by Peer Wulff), Flex-hM4Di (see35, kindly provided by Benjamin Rost) or loxp-hM3Dq (The Jackson Laboratory, Stock No. 026220) animals and experiments performed from adolescent (p45 – p70 ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Mutant Reverse (oIMR8052, The Jackson Laboratory) - GCGAAGAGTTTGTCCTCAACC ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Reverse (oIMR8546, The Jackson Laboratory) - 5’-GGAGCGGGAGAAATGGATATG-3’ ...
-
bioRxiv - Immunology 2023Quote: ... B6.Rosa26stop- tdTomato mice (JAX: 007914) were from Jackson Laboratories (Bar Harbor, ME).
-
bioRxiv - Immunology 2023Quote: ... the corresponding CRISPR/Cas9 reagents were microinjected into C57BL/6 (Jackson Laboratories) 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories) ...
-
bioRxiv - Immunology 2023Quote: LRRK2 G2019S KI (LRRK2 KI) mice (37) were all purchased from Jackson Laboratory (JAX030961). To get littermate wild type control mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 23 VIP-Cre × Ai14 mice (JAX 010908 and JAX 007914, Jackson Laboratory; tdTomato expressed in VIP interneurons) ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 SOM-Cre mice (JAX 013044, Jackson Laboratory; Cre expressed in SOM interneurons) and 3 SOM-Cre × Ai14 mice (JAX 013044 and JAX 007914 ...
-
bioRxiv - Neuroscience 2023Quote: ... 24 VIP-Cre mice (JAX 010908, Jackson Laboratory; Cre expressed in VIP interneurons), 23 VIP-Cre × Ai14 mice (JAX 010908 and JAX 007914 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 SOM-Cre × Ai14 mice (JAX 013044 and JAX 007914, Jackson Laboratory; tdTomato expressed in SOM interneurons ...
-
bioRxiv - Neuroscience 2023Quote: ... BalbC female mice (Jackson Laboratory) were ovariectomized in-house ...
-
bioRxiv - Cell Biology 2023Quote: ... the Dat- Cre line Slc6a3tm1(cre)Xz/J (Jackson Laboratories stock #020080(57)) ...
-
bioRxiv - Cell Biology 2023Quote: ... the HSA-MCM line Tg(ACTA1-cre/Esr1*)2Kesr/J (Jackson Laboratories stock #025750(56)) ...
-
bioRxiv - Microbiology 2023Quote: C57BL/6 female mice from six- to eight-week-old were purchased from Jackson laboratory, room MP14 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: We used C57BL/6J mice (Jackson Laboratory, Bar Harbor, Maine, Stock #000664), aged 3-6 months in this study ...
-
bioRxiv - Microbiology 2023Quote: ... 12-week-old male K18-hACE2 transgenic mice (Jackson Laboratory) were housed in HEPA-filtered ...
-
bioRxiv - Microbiology 2023Quote: Female 6–8-week-old BALB/c mice (n = 5/group) (Jackson Laboratories) were i.n ...
-
bioRxiv - Microbiology 2023Quote: Female 6–8-week-old BALB/c mice (n = 5/group) (Jackson Laboratories) were intranasally (i.n. ...
-
bioRxiv - Microbiology 2023Quote: ... 8 to 10-week-old C57BL/6 female mice (Jackson Laboratories, Bar Harbor, ME) were anesthetized with a 0.2 mL mixture of ketamine (6.7 mg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... Male C57BL/6J mice (purchased from Jackson Laboratory) aged 4 to 10 weeks old were used in the present study.
-
bioRxiv - Neuroscience 2023Quote: Orexin knockout mice were generated from breeders obtained from Jackson Laboratory (B6.129S6-Hcrttm1Ywa/J). Mice were genotyped using PCR with genomic primers 5’-GACGACGGCCTCAGACTTCTTGGG ...
-
bioRxiv - Neuroscience 2023Quote: ... StingGt/Gtalso known as Goldenticket mice (Tmem173Gt) and the suggested controls C57BL/6J WT (Lot: 000664) purchased from Jackson laboratory.
-
bioRxiv - Genetics 2023Quote: ... were purchased from Jackson laboratory. The genotypes of the mice and embryos/fetuses were determined by PCR-based genotyping.
-
bioRxiv - Genetics 2023Quote: C57BL/6J mice (stock number: 000664) were obtained from Jackson Laboratories. Animals were allowed free access to food and water and maintained on a standard chow diet ...