Labshake search
Citations for The Jackson Laboratory :
2701 - 2750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Jackson Laboratory and infected with the wild type JE2 strain (WT ...
-
bioRxiv - Microbiology 2023Quote: ... and K18-hACE2 mice (The Jackson laboratory, Stock No. 034860) were propagated at the UMN and maintained in specific pathogen-free conditions ...
-
bioRxiv - Genetics 2023Quote: ... and CAST/EiJ (CAST)) and DO mice were purchased from Jackson Laboratories (Bar Harbor, ME) and maintained at the University of Wisconsin-Madison ...
-
bioRxiv - Genetics 2023Quote: ... Briefly, 478 Diversity Outbred (DO) mice (236 female, 242 male) were obtained from Jackson Laboratories (Bar Harbor, ME) and maintained on a high-fat ...
-
bioRxiv - Immunology 2023Quote: ... Rosa26LSL-DPR/LSL-DPR mice were crossed to LCMV-specific transgenic TCR (P14) mice (83) (Jackson Labs, Strain # 004694) and to Cre-ERT2 mice (Jackson Labs ...
-
bioRxiv - Genetics 2023Quote: ... donkey anti-guinea pig Cy3 1:500 (Jackson laboratories #706-165-148), donkey anti-mouse Alexa Fluor 488 1:500 (Jackson laboratories #715-545-150).
-
bioRxiv - Genetics 2023Quote: ... Secondary antibody concentrations used were as follows: donkey anti-rabbit Alexa Fluor 647 1:500 (Jackson laboratories #711-605-152), donkey anti-guinea pig Cy3 1:500 (Jackson laboratories #706-165-148) ...
-
bioRxiv - Immunology 2023Quote: The K18+hACE2 mouse model (Jackson Laboratory) was chosen based on internal data and literature indicating that SARS-CoV-2 productively replicates in this mouse model expressing human ACE2 [29] ...
-
bioRxiv - Immunology 2023Quote: LysMCre (B6.129P2-Lyz2tm1(cre)Ifo/J, Jax 004781), Rac1f/f (Rac1tm1Djk/J, Jax 005550) mice were purchased from Jackson Laboratories. R26dsRed mice were described previously (Luche et al. ...
-
bioRxiv - Genomics 2023Quote: C57BL/6J mice were purchased from Jackson Laboratory and maintained with 12-h light/12-h dark cycles and food and water ad libitum ...
-
bioRxiv - Immunology 2023Quote: Female BALB/c mice (Jackson Laboratories) were immunized intramuscularly with 22 µmol purified nanoparticle immunogen in the presence or absence of AddaVax™ (InvivoGen ...
-
bioRxiv - Immunology 2023Quote: ... BALB/c and Sv129 mice from Jackson Laboratories were used ...
-
bioRxiv - Immunology 2023Quote: ... Disease progression and immune responses in wild-type C57BL/6 mice were compared with the immunocompromised Rag-1−/− mouse strain on a C57BL/6 background (Jackson Laboratories). All mice were housed in specific pathogen-free conditions in individually ventilated cages within the University of Cape Town biosafety level 2 (BSL2 ...
-
bioRxiv - Immunology 2023Quote: ... Ccr5-/- (B6.129P2-Ccr5tm1Kuz/J, The Jackson Laboratory) (Kuziel et al. ...
-
bioRxiv - Genomics 2023Quote: ... and NZO/HlLtJ - #002105) have been continuously outbred by Jackson Laboratory to create and maintain the Diversity Outbred population (#009376 ...
-
bioRxiv - Immunology 2023Quote: XORfl/fl//LysM-Cre mice were generated by crossing XORfl/fl mice with B6.129P2-Lyz2tm1(cre)Ifo/J (The Jackson Laboratory, strain # 004781). Mice were selected to be heterozygous for Cre recombinase and homozygous for the XOR “floxed’ allele (XORfl/fl ...
-
bioRxiv - Immunology 2023Quote: ... K14-Cre transgenic mice were purchased from Jackson laboratories. Macroscopic characterization of the skin inflammatory phenotype was performed by monitoring survival and lesion scoring at different time points ...
-
bioRxiv - Immunology 2023Quote: ... and Cxcr3-/- (B6.129P2-Cxcr3tm1/J, The Jackson Laboratory). Ccr6-/- mice were generated by Ozgene (Perth ...
-
bioRxiv - Immunology 2023Quote: ... and Alb-Cre mice (Jackson Labs, stock 003574) were crossed to produce the HcKO line ...
-
bioRxiv - Immunology 2023Quote: ... PcKO mice were produced by crossing the ST6Gal1-flox mice with Pf4-Cre mice (Jackson Labs, stock 008535). PHcKO mice were created by crossing HcKO and PcKO mice ...
-
bioRxiv - Immunology 2023Quote: ... B6.129S(FVB)-Bcl6tm1.1Dent/J were from Jackson Laboratories (strain #023727) (common name ...
-
bioRxiv - Immunology 2023Quote: Background strains for androgen receptor knockout were originally purchased from Jackson Laboratories (Bar Harbor, ME). Ksp-Cre × ARf/f mice were generated by crossing B6.129S1-Artm2.1Reb/J (#018450 ...
-
bioRxiv - Immunology 2023Quote: ... whereas Piezo1-tdTomato (029214) and Salsa6f (031968) were purchased from Jackson Laboratory. The Piezo1 fl/fl (0292143 ...
-
bioRxiv - Immunology 2023Quote: C57BL/6J mice were purchased from Jackson Laboratories (Bar Harbor, ME). Animals were housed under pathogen-free conditions in Washington University School of Medicine animal facilities ...
-
bioRxiv - Microbiology 2023Quote: Experimental animals used in this study were 6-8 weeks old BALB/cJ mice obtained from Jackson Laboratories (Bar Harbor, ME). They were provided with sterile food and water ad libitum and housed in filtered cages with 3-4 mice per cage ...
-
bioRxiv - Microbiology 2023Quote: Wildtype (WT) C57BL/6J mice were purchased from Jackson Laboratory (Bar Harbor, Maine) and maintained using a protocol approved by the University of Pittsburgh Institutional Animal Care and Use Committee ...
-
bioRxiv - Neuroscience 2023Quote: ... WT C57BL/6J (strain #000664) mice were purchased from Jackson Laboratory and bred in the Georgetown University Department of Comparative Medicine animal facility ...
-
bioRxiv - Neuroscience 2023Quote: ... ChAT-Cre (strain #031661) and Ai9/tdTomato (strain #007909) mice on the C57BL/6J background were purchased from Jackson Laboratory and crossed to produce ChAT-Cre/TdTomato mice ...
-
bioRxiv - Microbiology 2023Quote: ... Specific pathogen-free (SPF) mice were purchased from Jackson Labs. Germ-free (GF ...
-
bioRxiv - Neuroscience 2023Quote: ... stock n°020080) mice were obtained from Jackson laboratory and bred with 2- to 10-months old C57BL/6 wild type in an in-house animal facility ...
-
bioRxiv - Physiology 2023Quote: ... HSA–Cre (stock #006149) transgenic mice were obtained from Jackson Laboratory (Bar Harbor, ME). Homozygous floxed Pank4 mice were then crossed with HSA–Cre mice to obtain muscle-specific Pank4 KO (Pank4flox/flox:HSA-Cre-/+ ...
-
bioRxiv - Systems Biology 2023Quote: ... and geriatric (26 mo) C57BL/6J mice (Jackson Laboratory # 000664; NIA Aged Rodent Colonies) by injecting both tibialis anterior (TA ...
-
bioRxiv - Microbiology 2023Quote: ... Male 7-week-old C57BL/6 mice obtained from Jackson Laboratory were used for all experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Prox1-CreERT2 30 and Ai14 reporter31 (Stock No. 007914; Jackson Laboratory) mice were crossed to generate tamoxifen inducible ...
-
bioRxiv - Neuroscience 2023Quote: ... Agrptm1(cre)Lowl/J (AgRP-IRES-Cre148, 012899, The Jackson Laboratory), Mc4rtm3.1(cre)Lowl/J (MC4R-2A-Cre44 ...
-
bioRxiv - Neuroscience 2023Quote: ... loxp-mG5 (see32, kindly provided by Peer Wulff), Flex-hM4Di (see35, kindly provided by Benjamin Rost) or loxp-hM3Dq (The Jackson Laboratory, Stock No. 026220) animals and experiments performed from adolescent (p45 – p70 ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Mutant Reverse (oIMR8052, The Jackson Laboratory) - GCGAAGAGTTTGTCCTCAACC ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Reverse (oIMR8546, The Jackson Laboratory) - 5’-GGAGCGGGAGAAATGGATATG-3’ ...
-
bioRxiv - Physiology 2023Quote: DBA/2J (D2)-mdx (stock #001801) and D2 WT (stock #000671) were ordered from Jackson Laboratories at 5-6 weeks of age ...
-
bioRxiv - Physiology 2023Quote: C57BL/6J (The Jackson Laboratory # 000664) and ApobTG / CetpTG double-transgenic mice were used for in vivo studies of plasma clearance of the HTPI peptide ...
-
bioRxiv - Immunology 2023Quote: LRRK2 G2019S KI (LRRK2 KI) mice (37) were all purchased from Jackson Laboratory (JAX030961). To get littermate wild type control mice ...
-
bioRxiv - Immunology 2023Quote: C57BL/6J mice were purchased from Jackson Laboratories. All mice used in these experiments were females 8 weeks of age ...
-
bioRxiv - Immunology 2023Quote: ... Mx1gfp mice were purchased from Jackson Laboratories (Strain #033219) and bred in the Stanford Research Animal Facility ...
-
bioRxiv - Immunology 2023Quote: ... Tlr2−/− mice were either obtained from colonies bred at Jackson Laboratories or purchased from Jackson Laboratories (Myd88−/− ...
-
bioRxiv - Neuroscience 2023Quote: ... Imaging data were collected from 10 male C57BL/6J mice that were eight weeks old at the initiation of behavior task training (stock no. 000664, Jackson Labs).
-
bioRxiv - Immunology 2023Quote: ... and then crossed with LysM-Cre expressing mice (The Jackson Laboratory, 004781) to generate macrophage-specific Slc30a1 knockout (Slc30a1fl/flLysMCre ...
-
bioRxiv - Immunology 2023Quote: ... Female B6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). Mice were maintained under specific pathogen-free conditions in the same room for 9-10 days and infected at 8-12 weeks of age ...
-
bioRxiv - Microbiology 2023Quote: ... Bone marrow was collected from the femur and tibia of female BALB/c mice (Jackson Laboratories), RBCs lysed (Invitrogen 10x RBC Lysis buffer) ...
-
bioRxiv - Neuroscience 2023Quote: ... including: wildtype C57BL/6J mice (Jackson Laboratory, RRID:IMSR_JAX:000664), Drd1-Cre heterozygote mice (MMRRC ...
-
bioRxiv - Physiology 2023Quote: ... all mice were homozygous for the dual-fluorescence Cre-reporter allele ROSAmT/mG (Jackson Laboratory; strain #: 007576); thus ...